Incidental Mutation 'R1986:Otogl'
ID220683
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 039998-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R1986 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 107794190 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably null
Transcript: ENSMUST00000165341
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,419,328 S105P probably damaging Het
2610507B11Rik A T 11: 78,274,612 H1318L probably damaging Het
9930111J21Rik2 T A 11: 49,019,292 K771N possibly damaging Het
Abcc2 A G 19: 43,829,879 E1268G probably damaging Het
Adamts4 T C 1: 171,256,675 F574L possibly damaging Het
Adamts9 A G 6: 92,796,394 V1165A probably benign Het
Agap2 A T 10: 127,083,044 K430* probably null Het
Amn G T 12: 111,274,997 G232V probably damaging Het
Ank3 A G 10: 69,867,428 E297G probably damaging Het
Arhgap45 T C 10: 80,020,696 L26P probably damaging Het
Atp10b C A 11: 43,172,768 Q177K probably benign Het
Bbs10 A T 10: 111,299,257 D77V probably damaging Het
Bpifa1 T A 2: 154,144,336 L127Q probably damaging Het
Brinp2 T C 1: 158,246,778 N591S probably damaging Het
C2cd2 A C 16: 97,870,271 V476G probably damaging Het
C7 T A 15: 5,012,012 T471S possibly damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Cadps2 A G 6: 23,323,380 F1001L probably damaging Het
Ccdc188 T C 16: 18,218,843 S216P probably damaging Het
Ccdc24 A G 4: 117,872,016 L88P probably damaging Het
Dab1 T C 4: 104,613,215 I65T probably damaging Het
Dock4 A T 12: 40,730,063 D621V probably damaging Het
Drd5 A T 5: 38,320,113 M150L probably damaging Het
Eef2k T A 7: 120,873,346 M94K possibly damaging Het
Epg5 A G 18: 77,982,306 probably null Het
Epsti1 T C 14: 77,932,233 probably null Het
Ern2 T A 7: 122,171,529 D754V probably benign Het
Fam129c T A 8: 71,603,760 I368N possibly damaging Het
Fbxo6 A G 4: 148,146,095 Y237H probably damaging Het
Fbxw24 A G 9: 109,607,056 S303P probably damaging Het
Fpr-rs3 A T 17: 20,623,841 probably null Het
Gab1 G T 8: 80,766,381 T679K probably damaging Het
Gbp9 C A 5: 105,105,724 V42F probably damaging Het
Gbp9 A T 5: 105,105,786 V21E probably damaging Het
Gm14085 A G 2: 122,527,429 T655A probably benign Het
Gm20821 A G Y: 9,783,927 Q183R probably benign Het
Gpatch11 A T 17: 78,843,837 I226F probably benign Het
Hephl1 T G 9: 15,054,552 E1035A probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Ifna13 A G 4: 88,644,351 V12A probably benign Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Irgm2 A G 11: 58,219,558 D37G probably benign Het
Irs1 A G 1: 82,288,765 S577P probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Krtap4-16 T C 11: 99,851,496 Q26R unknown Het
Lig1 T A 7: 13,309,142 Y837* probably null Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Map3k20 C T 2: 72,441,294 Q589* probably null Het
Masp1 T G 16: 23,483,461 M347L probably benign Het
Mgat3 A T 15: 80,212,189 I406F probably benign Het
Mmp1b T G 9: 7,368,577 D425A probably benign Het
Mss51 T C 14: 20,483,191 H404R probably benign Het
Myo15b A T 11: 115,882,875 H1911L probably benign Het
Nedd4l A G 18: 65,143,803 D102G probably damaging Het
Npc2 T C 12: 84,760,749 K112E probably benign Het
Nuggc T A 14: 65,641,921 V694E probably damaging Het
Olfm1 T G 2: 28,214,706 V157G probably benign Het
Olfr476 T C 7: 107,967,670 V91A probably benign Het
Olfr63 T C 17: 33,269,515 S264P probably benign Het
Ovgp1 G A 3: 105,974,935 C38Y probably damaging Het
Pisd A T 5: 32,737,328 S344T probably damaging Het
Psme4 T C 11: 30,830,352 V840A probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Rin2 T A 2: 145,878,940 M731K probably damaging Het
Scgb1b19 T C 7: 33,287,683 probably null Het
Serpina10 A G 12: 103,628,255 I235T possibly damaging Het
Setbp1 T A 18: 78,858,544 E636V probably damaging Het
Sh3d21 C T 4: 126,162,497 E101K probably damaging Het
Ski T G 4: 155,221,691 D225A probably damaging Het
Slc29a3 T C 10: 60,723,814 Y187C probably damaging Het
Sort1 T A 3: 108,345,727 D494E possibly damaging Het
Sphkap A T 1: 83,277,922 L702Q probably damaging Het
Srr A G 11: 74,908,719 I285T probably damaging Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Suds3 A T 5: 117,108,352 N112K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tesk2 T C 4: 116,751,193 L104P probably damaging Het
Tie1 C T 4: 118,478,963 R702H probably benign Het
Tpo G T 12: 30,119,466 A90E probably damaging Het
Trim30a T C 7: 104,411,465 D368G probably damaging Het
Ugt2a2 A T 5: 87,460,579 M633K possibly damaging Het
Vars2 A G 17: 35,660,061 W626R probably damaging Het
Vmn2r10 A T 5: 109,006,254 Y61* probably null Het
Vmn2r95 T C 17: 18,451,543 V514A probably benign Het
Vwa5a T G 9: 38,737,814 probably benign Het
Zfp365 A T 10: 67,909,856 C31S probably damaging Het
Zfp397 A T 18: 23,960,051 I198F possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp593 T C 4: 134,244,895 E100G possibly damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTGCACTGAAATCACAG -3'
(R):5'- TACCTGGTGTGTCAATGGC -3'

Sequencing Primer
(F):5'- TACTTGGACGTCTGGAAG -3'
(R):5'- GTGTCAATGGCTTAATTTCAGCTTC -3'
Posted On2014-08-25