Incidental Mutation 'R2027:Ccdc107'
ID220760
Institutional Source Beutler Lab
Gene Symbol Ccdc107
Ensembl Gene ENSMUSG00000028461
Gene Namecoiled-coil domain containing 107
Synonyms1110032O22Rik
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43492900-43495921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43495874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000103555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030181] [ENSMUST00000054538] [ENSMUST00000107922]
Predicted Effect probably benign
Transcript: ENSMUST00000030181
AA Change: V234A

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030181
Gene: ENSMUSG00000028461
AA Change: V234A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 97 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054538
SMART Domains Protein: ENSMUSP00000055293
Gene: ENSMUSG00000051517

DomainStartEndE-ValueType
RhoGEF 26 196 4.92e-31 SMART
PH 228 333 5.71e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107922
AA Change: V259A

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103555
Gene: ENSMUSG00000028461
AA Change: V259A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 97 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129378
Predicted Effect probably benign
Transcript: ENSMUST00000136005
SMART Domains Protein: ENSMUSP00000118144
Gene: ENSMUSG00000051517

DomainStartEndE-ValueType
Pfam:RhoGEF 53 153 2.5e-18 PFAM
PH 154 256 1.97e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147124
Predicted Effect probably benign
Transcript: ENSMUST00000152134
SMART Domains Protein: ENSMUSP00000119911
Gene: ENSMUSG00000051517

DomainStartEndE-ValueType
Blast:PH 2 82 7e-38 BLAST
SCOP:d1kz7a2 2 88 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226420
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein which contains a coiled-coil domain in the central region. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Ccdc107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Ccdc107 APN 4 43493453 nonsense probably null
IGL01469:Ccdc107 APN 4 43495751 missense probably benign 0.37
IGL02160:Ccdc107 APN 4 43495736 missense probably damaging 0.99
IGL02884:Ccdc107 APN 4 43495228 nonsense probably null
R0028:Ccdc107 UTSW 4 43495549 missense probably benign
R5435:Ccdc107 UTSW 4 43493519 missense probably damaging 0.99
R5546:Ccdc107 UTSW 4 43495685 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCACAGAGGCCAGCATACC -3'
(R):5'- CATCTCGGTAGCCTCAGAAAC -3'

Sequencing Primer
(F):5'- ATACCCTTTACTGAGGACCTGGG -3'
(R):5'- AAGGGCAGAACTGTGGCTCTC -3'
Posted On2014-08-25