Incidental Mutation 'R1986:Zfp407'
ID220761
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Namezinc finger protein 407
Synonyms6430585N13Rik, LOC240469, LOC381139
MMRRC Submission 039998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1986 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location84128027-84589725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84559773 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1072 (A1072T)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: A1072T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: A1072T

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182297
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,419,328 S105P probably damaging Het
2610507B11Rik A T 11: 78,274,612 H1318L probably damaging Het
9930111J21Rik2 T A 11: 49,019,292 K771N possibly damaging Het
Abcc2 A G 19: 43,829,879 E1268G probably damaging Het
Adamts4 T C 1: 171,256,675 F574L possibly damaging Het
Adamts9 A G 6: 92,796,394 V1165A probably benign Het
Agap2 A T 10: 127,083,044 K430* probably null Het
Amn G T 12: 111,274,997 G232V probably damaging Het
Ank3 A G 10: 69,867,428 E297G probably damaging Het
Arhgap45 T C 10: 80,020,696 L26P probably damaging Het
Atp10b C A 11: 43,172,768 Q177K probably benign Het
Bbs10 A T 10: 111,299,257 D77V probably damaging Het
Bpifa1 T A 2: 154,144,336 L127Q probably damaging Het
Brinp2 T C 1: 158,246,778 N591S probably damaging Het
C2cd2 A C 16: 97,870,271 V476G probably damaging Het
C7 T A 15: 5,012,012 T471S possibly damaging Het
Cacna1b A T 2: 24,648,986 Y1488N probably damaging Het
Cadps2 A G 6: 23,323,380 F1001L probably damaging Het
Ccdc188 T C 16: 18,218,843 S216P probably damaging Het
Ccdc24 A G 4: 117,872,016 L88P probably damaging Het
Dab1 T C 4: 104,613,215 I65T probably damaging Het
Dock4 A T 12: 40,730,063 D621V probably damaging Het
Drd5 A T 5: 38,320,113 M150L probably damaging Het
Eef2k T A 7: 120,873,346 M94K possibly damaging Het
Epg5 A G 18: 77,982,306 probably null Het
Epsti1 T C 14: 77,932,233 probably null Het
Ern2 T A 7: 122,171,529 D754V probably benign Het
Fam129c T A 8: 71,603,760 I368N possibly damaging Het
Fbxo6 A G 4: 148,146,095 Y237H probably damaging Het
Fbxw24 A G 9: 109,607,056 S303P probably damaging Het
Fpr-rs3 A T 17: 20,623,841 probably null Het
Gab1 G T 8: 80,766,381 T679K probably damaging Het
Gbp9 C A 5: 105,105,724 V42F probably damaging Het
Gbp9 A T 5: 105,105,786 V21E probably damaging Het
Gm14085 A G 2: 122,527,429 T655A probably benign Het
Gm20821 A G Y: 9,783,927 Q183R probably benign Het
Gpatch11 A T 17: 78,843,837 I226F probably benign Het
Hephl1 T G 9: 15,054,552 E1035A probably damaging Het
Hspa4l T C 3: 40,760,401 V156A probably damaging Het
Ifna13 A G 4: 88,644,351 V12A probably benign Het
Il24 G A 1: 130,882,531 T196I probably benign Het
Irgm2 A G 11: 58,219,558 D37G probably benign Het
Irs1 A G 1: 82,288,765 S577P probably damaging Het
Kif21b G A 1: 136,147,546 D166N probably damaging Het
Krtap4-16 T C 11: 99,851,496 Q26R unknown Het
Lig1 T A 7: 13,309,142 Y837* probably null Het
Lrrc69 T C 4: 14,708,669 E225G possibly damaging Het
Map3k20 C T 2: 72,441,294 Q589* probably null Het
Masp1 T G 16: 23,483,461 M347L probably benign Het
Mgat3 A T 15: 80,212,189 I406F probably benign Het
Mmp1b T G 9: 7,368,577 D425A probably benign Het
Mss51 T C 14: 20,483,191 H404R probably benign Het
Myo15b A T 11: 115,882,875 H1911L probably benign Het
Nedd4l A G 18: 65,143,803 D102G probably damaging Het
Npc2 T C 12: 84,760,749 K112E probably benign Het
Nuggc T A 14: 65,641,921 V694E probably damaging Het
Olfm1 T G 2: 28,214,706 V157G probably benign Het
Olfr476 T C 7: 107,967,670 V91A probably benign Het
Olfr63 T C 17: 33,269,515 S264P probably benign Het
Otogl T A 10: 107,794,190 probably null Het
Ovgp1 G A 3: 105,974,935 C38Y probably damaging Het
Pisd A T 5: 32,737,328 S344T probably damaging Het
Psme4 T C 11: 30,830,352 V840A probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rims2 T A 15: 39,345,314 M171K probably damaging Het
Rin2 T A 2: 145,878,940 M731K probably damaging Het
Scgb1b19 T C 7: 33,287,683 probably null Het
Serpina10 A G 12: 103,628,255 I235T possibly damaging Het
Setbp1 T A 18: 78,858,544 E636V probably damaging Het
Sh3d21 C T 4: 126,162,497 E101K probably damaging Het
Ski T G 4: 155,221,691 D225A probably damaging Het
Slc29a3 T C 10: 60,723,814 Y187C probably damaging Het
Sort1 T A 3: 108,345,727 D494E possibly damaging Het
Sphkap A T 1: 83,277,922 L702Q probably damaging Het
Srr A G 11: 74,908,719 I285T probably damaging Het
Stam2 T C 2: 52,709,626 T257A possibly damaging Het
Suds3 A T 5: 117,108,352 N112K probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tesk2 T C 4: 116,751,193 L104P probably damaging Het
Tie1 C T 4: 118,478,963 R702H probably benign Het
Tpo G T 12: 30,119,466 A90E probably damaging Het
Trim30a T C 7: 104,411,465 D368G probably damaging Het
Ugt2a2 A T 5: 87,460,579 M633K possibly damaging Het
Vars2 A G 17: 35,660,061 W626R probably damaging Het
Vmn2r10 A T 5: 109,006,254 Y61* probably null Het
Vmn2r95 T C 17: 18,451,543 V514A probably benign Het
Vwa5a T G 9: 38,737,814 probably benign Het
Zfp365 A T 10: 67,909,856 C31S probably damaging Het
Zfp397 A T 18: 23,960,051 I198F possibly damaging Het
Zfp593 T C 4: 134,244,895 E100G possibly damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84561752 missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84562720 nonsense probably null
IGL02110:Zfp407 APN 18 84559040 missense probably benign 0.00
IGL02343:Zfp407 APN 18 84209724 missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84558641 missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84559031 nonsense probably null
IGL02946:Zfp407 APN 18 84560709 missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84350975 missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84209721 missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84560797 missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84209955 missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84561268 missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84432420 missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84560411 missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84558711 missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84562567 missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R0787:Zfp407 UTSW 18 84209022 missense probably damaging 1.00
R0787:Zfp407 UTSW 18 84209346 missense probably benign 0.00
R1065:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1086:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1165:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1186:Zfp407 UTSW 18 84209448 missense probably benign 0.39
R1203:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1312:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1345:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1385:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1421:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1430:Zfp407 UTSW 18 84209455 missense probably benign 0.18
R1436:Zfp407 UTSW 18 84343071 splice site probably benign
R1498:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1526:Zfp407 UTSW 18 84561033 missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84209638 missense probably benign 0.00
R1594:Zfp407 UTSW 18 84209331 missense probably benign 0.01
R1628:Zfp407 UTSW 18 84354533 missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84562157 missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84559336 missense probably benign 0.01
R1984:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R1985:Zfp407 UTSW 18 84559773 missense probably benign 0.14
R2151:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84209649 missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84209793 missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84559880 missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84558397 nonsense probably null
R3407:Zfp407 UTSW 18 84558872 missense probably benign 0.08
R3432:Zfp407 UTSW 18 84208746 missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84560352 missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84559596 missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84343007 missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84562731 nonsense probably null
R4447:Zfp407 UTSW 18 84562694 missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84562914 missense probably benign 0.01
R4881:Zfp407 UTSW 18 84559703 missense probably benign 0.27
R4936:Zfp407 UTSW 18 84559464 missense probably benign 0.00
R5194:Zfp407 UTSW 18 84561309 missense probably benign 0.05
R5243:Zfp407 UTSW 18 84561091 missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84315926 missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84561137 missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84561044 missense probably benign 0.35
R5739:Zfp407 UTSW 18 84208742 makesense probably null
R5806:Zfp407 UTSW 18 84558614 missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84560524 missense probably benign 0.01
R6187:Zfp407 UTSW 18 84559009 missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84560349 missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84432411 missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84208830 missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84343069 splice site probably null
R6899:Zfp407 UTSW 18 84561434 missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84561857 missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84558476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGCACAGAGTACTTTAGAC -3'
(R):5'- GAGGTTGCAGGTTCAAGTGAC -3'

Sequencing Primer
(F):5'- GGAGCACAGAGTACTTTAGACATACC -3'
(R):5'- CAATAAGTGTCTTCAGTGTGAGTTC -3'
Posted On2014-08-25