Incidental Mutation 'R2027:Rabgef1'
ID220773
Institutional Source Beutler Lab
Gene Symbol Rabgef1
Ensembl Gene ENSMUSG00000025340
Gene NameRAB guanine nucleotide exchange factor (GEF) 1
SynonymsRas negative regulator Rabex-5
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location130171798-130214342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130208779 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 231 (D231G)
Ref Sequence ENSEMBL: ENSMUSP00000119245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026390] [ENSMUST00000119027] [ENSMUST00000119797] [ENSMUST00000148264]
Predicted Effect probably benign
Transcript: ENSMUST00000026390
AA Change: D230G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026390
Gene: ENSMUSG00000025340
AA Change: D230G

DomainStartEndE-ValueType
ZnF_A20 16 40 1.5e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119027
SMART Domains Protein: ENSMUSP00000112537
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 221 7e-51 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119542
Predicted Effect probably benign
Transcript: ENSMUST00000119797
AA Change: D230G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114103
Gene: ENSMUSG00000025340
AA Change: D230G

DomainStartEndE-ValueType
ZnF_A20 16 40 1.4e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125937
Predicted Effect probably benign
Transcript: ENSMUST00000143865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147493
Predicted Effect possibly damaging
Transcript: ENSMUST00000148264
AA Change: D231G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119245
Gene: ENSMUSG00000025340
AA Change: D231G

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 250 1e-72 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202729
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RABGEF1 forms a complex with rabaptin-5 (RABPT5; MIM 603616) that is required for endocytic membrane fusion, and it serves as a specific guanine nucleotide exchange factor (GEF) for RAB5 (RAB5A; MIM 179512) (Horiuchi et al., 1997 [PubMed 9323142]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Nullizygous mutations can cause neonatal or postnatal lethality associated with severe skin inflammation, high mast cell numbers and serum levels of IgE and histamine, and enhanced mast cell degranulation and release of mediators and cytokines in response to high affinity IgE receptor aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Rabgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Rabgef1 APN 5 130208724 nonsense probably null
IGL00964:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL01830:Rabgef1 APN 5 130212066 missense possibly damaging 0.88
IGL02161:Rabgef1 APN 5 130207099 splice site probably benign
IGL02231:Rabgef1 APN 5 130211975 missense probably damaging 1.00
IGL02429:Rabgef1 APN 5 130210488 missense possibly damaging 0.48
IGL02620:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL03005:Rabgef1 APN 5 130208797 missense probably damaging 1.00
LCD18:Rabgef1 UTSW 5 130187586 frame shift probably null
R0227:Rabgef1 UTSW 5 130190990 missense probably damaging 1.00
R1028:Rabgef1 UTSW 5 130212862 nonsense probably null
R1838:Rabgef1 UTSW 5 130213021 missense probably benign 0.01
R2074:Rabgef1 UTSW 5 130187561 missense probably benign 0.21
R2079:Rabgef1 UTSW 5 130190935 missense probably damaging 0.99
R2355:Rabgef1 UTSW 5 130212087 missense probably benign 0.29
R3625:Rabgef1 UTSW 5 130212120 critical splice donor site probably null
R3892:Rabgef1 UTSW 5 130208679 splice site probably benign
R5060:Rabgef1 UTSW 5 130212003 missense probably damaging 1.00
R5249:Rabgef1 UTSW 5 130213000 missense probably benign 0.00
R6597:Rabgef1 UTSW 5 130191044 critical splice donor site probably null
R7223:Rabgef1 UTSW 5 130190960 missense probably benign 0.14
R7326:Rabgef1 UTSW 5 130187351 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCGAGTTACTGGAAGATGGCTG -3'
(R):5'- AACATGGGTCCTCTCTCCAG -3'

Sequencing Primer
(F):5'- TTGAGCTGCTATACCCCT -3'
(R):5'- GTCCTCTCTCCAGCCAGACAG -3'
Posted On2014-08-25