Incidental Mutation 'R2027:Itpr1'
ID220780
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission 040035-MU
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108386853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 812 (S812Y)
Ref Sequence ENSEMBL: ENSMUSP00000144880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: S812Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: S812Y

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203615
AA Change: S812Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: S812Y

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203995
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAATGAAATCTCCGGGCAGC -3'
(R):5'- TAGCAAAACTGCACCCTGG -3'

Sequencing Primer
(F):5'- AAATCTCCGGGCAGCTGGATG -3'
(R):5'- AACTGCACCCTGGCATCCTG -3'
Posted On2014-08-25