Incidental Mutation 'R2027:Olfr582'
ID220794
Institutional Source Beutler Lab
Gene Symbol Olfr582
Ensembl Gene ENSMUSG00000073961
Gene Nameolfactory receptor 582
SynonymsGA_x6K02T2PBJ9-5752857-5753801, MOR30-3
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103038024-103044040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103041524 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 15 (H15L)
Ref Sequence ENSEMBL: ENSMUSP00000095813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098212] [ENSMUST00000210119] [ENSMUST00000211036] [ENSMUST00000214021]
Predicted Effect probably benign
Transcript: ENSMUST00000098212
AA Change: H15L

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095813
Gene: ENSMUSG00000073961
AA Change: H15L

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 2.2e-109 PFAM
Pfam:7TM_GPCR_Srsx 42 179 1.6e-10 PFAM
Pfam:7tm_1 48 299 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210119
AA Change: H10L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000211036
AA Change: H10L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214021
AA Change: H10L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Olfr582
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Olfr582 APN 7 103042150 missense probably damaging 1.00
IGL02236:Olfr582 APN 7 103041721 missense possibly damaging 0.78
IGL02448:Olfr582 APN 7 103042397 missense possibly damaging 0.84
IGL03056:Olfr582 APN 7 103041751 missense possibly damaging 0.87
IGL03351:Olfr582 APN 7 103042130 missense probably damaging 1.00
IGL03368:Olfr582 APN 7 103041765 missense possibly damaging 0.93
R1762:Olfr582 UTSW 7 103042042 missense probably damaging 1.00
R3758:Olfr582 UTSW 7 103041970 missense probably benign 0.09
R4668:Olfr582 UTSW 7 103041851 missense probably benign
R5568:Olfr582 UTSW 7 103042310 missense possibly damaging 0.72
R5573:Olfr582 UTSW 7 103042340 missense probably damaging 1.00
R6005:Olfr582 UTSW 7 103041646 missense probably damaging 0.98
R7112:Olfr582 UTSW 7 103041655 missense probably damaging 0.98
R7223:Olfr582 UTSW 7 103041632 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CACTCAGTAGACTCCAATTCCAGG -3'
(R):5'- ACAAGGTCAGTGGTAGCCAG -3'

Sequencing Primer
(F):5'- TTTCTTTAGGAAATGATTGTCCCC -3'
(R):5'- TCAGTGGTAGCCAGCATGG -3'
Posted On2014-08-25