Incidental Mutation 'R2027:Pkn1'
ID220808
Institutional Source Beutler Lab
Gene Symbol Pkn1
Ensembl Gene ENSMUSG00000057672
Gene Nameprotein kinase N1
SynonymsPRK1, F730027O18Rik, PAK1, Prkcl1, Pkn, Stk3
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2027 (G1)
Quality Score221
Status Validated
Chromosome8
Chromosomal Location83666536-83699179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83671378 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 795 (V795A)
Ref Sequence ENSEMBL: ENSMUSP00000116235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect probably damaging
Transcript: ENSMUST00000005616
AA Change: V790A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672
AA Change: V790A

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019608
SMART Domains Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464

DomainStartEndE-ValueType
Pfam:7tm_1 52 354 2.3e-17 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect silent
Transcript: ENSMUST00000132945
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138898
Predicted Effect probably damaging
Transcript: ENSMUST00000144258
AA Change: V795A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672
AA Change: V795A

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212519
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase C superfamily. This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can be activated by phospholipids and by limited proteolysis. The 3-phosphoinositide dependent protein kinase-1 (PDPK1/PDK1) is reported to phosphorylate this kinase, which may mediate insulin signals to the actin cytoskeleton. The proteolytic activation of this kinase by caspase-3 or related proteases during apoptosis suggests its role in signal transduction related to apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneously formed GCs and developed an autoimmune-like disease with autoantibody production and glomerulonephritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Pkn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Pkn1 APN 8 83681006 missense probably damaging 0.96
IGL02058:Pkn1 APN 8 83681225 nonsense probably null
IGL03142:Pkn1 APN 8 83671023 missense possibly damaging 0.85
xinjiang UTSW 8 83692927 nonsense probably null
R0115:Pkn1 UTSW 8 83671029 missense probably damaging 0.99
R0157:Pkn1 UTSW 8 83692820 missense probably damaging 1.00
R0304:Pkn1 UTSW 8 83683607 splice site probably benign
R0450:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R0469:Pkn1 UTSW 8 83672324 missense probably damaging 1.00
R1419:Pkn1 UTSW 8 83673522 missense probably damaging 0.99
R1539:Pkn1 UTSW 8 83670337 missense possibly damaging 0.49
R2025:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2026:Pkn1 UTSW 8 83671378 missense probably damaging 1.00
R2029:Pkn1 UTSW 8 83677963 missense possibly damaging 0.92
R2886:Pkn1 UTSW 8 83681238 missense probably benign 0.28
R3017:Pkn1 UTSW 8 83670170 missense probably benign 0.13
R3402:Pkn1 UTSW 8 83670230 missense probably damaging 1.00
R4110:Pkn1 UTSW 8 83691199 missense probably benign 0.41
R4504:Pkn1 UTSW 8 83692927 nonsense probably null
R4739:Pkn1 UTSW 8 83671749 missense probably damaging 0.98
R4838:Pkn1 UTSW 8 83677966 missense probably damaging 1.00
R4857:Pkn1 UTSW 8 83684227 splice site probably null
R5239:Pkn1 UTSW 8 83684182 missense probably damaging 1.00
R5558:Pkn1 UTSW 8 83684722 missense probably damaging 1.00
R5613:Pkn1 UTSW 8 83677761 missense probably benign 0.00
R6169:Pkn1 UTSW 8 83681206 nonsense probably null
R6172:Pkn1 UTSW 8 83670755 missense possibly damaging 0.48
R6273:Pkn1 UTSW 8 83672270 missense probably damaging 0.96
R6318:Pkn1 UTSW 8 83683591 missense probably damaging 1.00
R6531:Pkn1 UTSW 8 83670293 missense probably benign 0.09
R6969:Pkn1 UTSW 8 83683426 missense probably damaging 1.00
R7142:Pkn1 UTSW 8 83693967 missense possibly damaging 0.50
R7157:Pkn1 UTSW 8 83671734 missense probably damaging 1.00
R7189:Pkn1 UTSW 8 83692673 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GCTCCAGATCATACTTCACGTG -3'
(R):5'- TCACCCTAGCAGCTTCAGAATAG -3'

Sequencing Primer
(F):5'- CCAGATCATACTTCACGTGGTAGG -3'
(R):5'- GCTTCAGAATAGTTCACCAGCTCTAG -3'
Posted On2014-08-25