Incidental Mutation 'R1971:Arnt'
ID220809
Institutional Source Beutler Lab
Gene Symbol Arnt
Ensembl Gene ENSMUSG00000015522
Gene Namearyl hydrocarbon receptor nuclear translocator
SynonymsESTM42, Hif1b, D3Ertd557e, bHLHe2
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95434388-95497240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95448393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 16 (S16L)
Ref Sequence ENSEMBL: ENSMUSP00000102778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107160] [ENSMUST00000107161]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015666
AA Change: S16L

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 69 128 2.9e-11 SMART
PAS 143 210 7.4e-13 SMART
low complexity region 231 242 N/A INTRINSIC
PAS 332 397 7.6e-10 SMART
PAC 404 447 9.6e-7 SMART
low complexity region 705 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090804
AA Change: S16L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102749
AA Change: S16L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 95 148 1e-14 SMART
PAS 163 230 1.51e-10 SMART
low complexity region 251 262 N/A INTRINSIC
PAS 352 417 1.55e-7 SMART
PAC 424 467 1.95e-4 SMART
low complexity region 725 738 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107160
AA Change: S16L

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102778
Gene: ENSMUSG00000015522
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107161
AA Change: S16L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522
AA Change: S16L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149051
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Arnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Arnt APN 3 95490340 missense probably damaging 0.98
IGL00949:Arnt APN 3 95487268 missense probably damaging 1.00
IGL01304:Arnt APN 3 95448385 missense probably damaging 1.00
IGL01634:Arnt APN 3 95470398 splice site probably benign
IGL01685:Arnt APN 3 95474681 missense probably damaging 1.00
IGL01768:Arnt APN 3 95491016 unclassified probably benign
IGL02738:Arnt APN 3 95495320 unclassified probably null
IGL02941:Arnt APN 3 95460370 splice site probably benign
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0420:Arnt UTSW 3 95470394 splice site probably benign
R0801:Arnt UTSW 3 95493846 missense possibly damaging 0.86
R1418:Arnt UTSW 3 95470399 splice site probably benign
R1523:Arnt UTSW 3 95489654 missense possibly damaging 0.77
R1956:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1957:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1958:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1969:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1970:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R3743:Arnt UTSW 3 95474705 missense possibly damaging 0.49
R4561:Arnt UTSW 3 95452613 missense probably damaging 0.96
R4780:Arnt UTSW 3 95488385 missense probably damaging 1.00
R4827:Arnt UTSW 3 95489913 unclassified probably null
R4913:Arnt UTSW 3 95490654 missense probably damaging 1.00
R5051:Arnt UTSW 3 95470337 missense probably benign 0.08
R5572:Arnt UTSW 3 95474704 missense possibly damaging 0.49
R5866:Arnt UTSW 3 95490726 unclassified probably benign
R6376:Arnt UTSW 3 95490625 missense probably damaging 0.99
R6491:Arnt UTSW 3 95476143 missense probably damaging 1.00
R6873:Arnt UTSW 3 95474575 missense probably damaging 1.00
R6920:Arnt UTSW 3 95490621 missense probably damaging 0.99
X0020:Arnt UTSW 3 95494565 missense probably benign 0.10
X0026:Arnt UTSW 3 95474630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGACTGCCTTCCTG -3'
(R):5'- ATTAGATGTGTGGTCAGGAATAAAC -3'

Sequencing Primer
(F):5'- GGTATATGCCTACCTATGAGTCAG -3'
(R):5'- TGTGGTCAGGAATAAACAAGAGCC -3'
Posted On2014-08-25