Incidental Mutation 'R2027:Zfp280b'
ID220832
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Namezinc finger protein 280B
SynonymsSuhw2, D10Jhu82e
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76032650-76043234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76038494 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 69 (L69S)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
Predicted Effect probably damaging
Transcript: ENSMUST00000061617
AA Change: L69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: L69S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218627
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 76039663 missense probably damaging 0.99
IGL02016:Zfp280b APN 10 76039111 missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 76039363 missense probably benign
IGL03233:Zfp280b APN 10 76039769 missense probably damaging 1.00
R0864:Zfp280b UTSW 10 76038305 missense probably benign 0.00
R1501:Zfp280b UTSW 10 76039769 missense probably damaging 1.00
R1643:Zfp280b UTSW 10 76039610 missense probably damaging 1.00
R2004:Zfp280b UTSW 10 76038536 missense probably benign 0.00
R2024:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2025:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2064:Zfp280b UTSW 10 76039183 missense probably damaging 1.00
R3729:Zfp280b UTSW 10 76039102 missense probably benign 0.33
R4634:Zfp280b UTSW 10 76038829 missense probably benign 0.00
R4812:Zfp280b UTSW 10 76039090 missense probably benign 0.24
R4968:Zfp280b UTSW 10 76039354 missense probably damaging 1.00
R5007:Zfp280b UTSW 10 76039214 missense probably damaging 1.00
R5123:Zfp280b UTSW 10 76039349 missense probably benign 0.02
R5503:Zfp280b UTSW 10 76039462 unclassified probably null
R5552:Zfp280b UTSW 10 76039663 nonsense probably null
R6954:Zfp280b UTSW 10 76039688 missense probably benign 0.36
R7299:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7301:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7485:Zfp280b UTSW 10 76039241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCAGAAATGGAGCAGCC -3'
(R):5'- TCAGACTCGGACAAAGGCTC -3'

Sequencing Primer
(F):5'- CAGCCATTCACGGTAGATGATG -3'
(R):5'- TCAATAGCAATAGGACTATCCGTCG -3'
Posted On2014-08-25