Incidental Mutation 'R2027:Efemp1'
ID220836
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2027 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28914696 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 250 (Y250F)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020759
AA Change: Y250F

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: Y250F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Predicted Effect probably benign
Transcript: ENSMUST00000139713
SMART Domains Protein: ENSMUSP00000114757
Gene: ENSMUSG00000020467

DomainStartEndE-ValueType
EGF 2 38 6.86e-4 SMART
EGF_like 39 83 3.49e-3 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Gnl1 A G 17: 35,982,958 N274D probably benign Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28915763 missense probably damaging 1.00
R2396:Efemp1 UTSW 11 28867941 missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28914590 missense probably benign 0.05
R5297:Efemp1 UTSW 11 28867868 missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7067:Efemp1 UTSW 11 28867926 missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGCTAAGACACAACTTGGTTC -3'
(R):5'- TTTGATCCACCCACAGAGGAC -3'

Sequencing Primer
(F):5'- CCTTCTGTGCGCTGGAATTAAAGAC -3'
(R):5'- GTTTCCCATTTCTAAATGATGTGC -3'
Posted On2014-08-25