Incidental Mutation 'R2027:Gnl1'
ID220873
Institutional Source Beutler Lab
Gene Symbol Gnl1
Ensembl Gene ENSMUSG00000024429
Gene Nameguanine nucleotide binding protein-like 1
SynonymsGnal1, Gna-rs1
MMRRC Submission 040035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2027 (G1)
Quality Score193
Status Validated
Chromosome17
Chromosomal Location35979851-35989462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35982958 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 274 (N274D)
Ref Sequence ENSEMBL: ENSMUSP00000084450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055454] [ENSMUST00000087200] [ENSMUST00000165613] [ENSMUST00000172429] [ENSMUST00000172900] [ENSMUST00000173585] [ENSMUST00000173724] [ENSMUST00000173872] [ENSMUST00000174849]
Predicted Effect probably benign
Transcript: ENSMUST00000055454
SMART Domains Protein: ENSMUSP00000052166
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
low complexity region 110 120 N/A INTRINSIC
ZnF_C3H1 158 184 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087200
AA Change: N274D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084450
Gene: ENSMUSG00000024429
AA Change: N274D

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
SCOP:d1egaa1 179 232 6e-3 SMART
Pfam:MMR_HSR1 362 465 1.4e-13 PFAM
low complexity region 550 583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165613
SMART Domains Protein: ENSMUSP00000125802
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172429
SMART Domains Protein: ENSMUSP00000129651
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172900
SMART Domains Protein: ENSMUSP00000134115
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173417
Predicted Effect probably benign
Transcript: ENSMUST00000173585
SMART Domains Protein: ENSMUSP00000134373
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
ZnF_C3H1 111 137 3.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173724
Predicted Effect probably benign
Transcript: ENSMUST00000173872
SMART Domains Protein: ENSMUSP00000134021
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 48 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174275
Predicted Effect probably benign
Transcript: ENSMUST00000174849
SMART Domains Protein: ENSMUSP00000134505
Gene: ENSMUSG00000038500

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GNL1 gene, identified in the human major histocompatibility complex class I region, shows a high degree of similarity with its mouse counterpart. The GNL1 gene is located less than 2 kb centromeric to HLA-E, in the same transcriptional orientation. GNL1 is telomeric to HLA-B and HLA-C. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,742,587 M55T possibly damaging Het
4932438A13Rik T A 3: 37,047,961 probably benign Het
A4gnt T C 9: 99,620,201 V138A possibly damaging Het
Aatk A G 11: 120,009,317 S1291P probably damaging Het
Adgrv1 C T 13: 81,595,182 V67M probably damaging Het
Apoa4 G A 9: 46,243,000 V300M probably damaging Het
Bcl2a1d A T 9: 88,731,385 V112E possibly damaging Het
Cabp2 T A 19: 4,087,126 M166K probably damaging Het
Camsap1 A G 2: 25,938,526 V1062A possibly damaging Het
Cap1 T G 4: 122,862,893 probably benign Het
Caprin2 A G 6: 148,877,887 Y141H probably damaging Het
Card11 T C 5: 140,906,767 Y181C probably damaging Het
Ccdc107 T C 4: 43,495,874 V259A probably benign Het
Chd9 A G 8: 90,907,991 probably benign Het
Col12a1 T C 9: 79,645,793 probably null Het
Cuzd1 T C 7: 131,320,091 T61A possibly damaging Het
Dbp C A 7: 45,708,276 D89E probably benign Het
Dhps A T 8: 85,072,611 N140Y probably damaging Het
Dido1 A T 2: 180,689,181 L158* probably null Het
Dnah9 T G 11: 65,955,338 N2958T probably benign Het
Dpp8 T A 9: 65,078,774 Y849N probably damaging Het
Dsg2 A G 18: 20,583,004 probably null Het
Efemp1 A T 11: 28,914,696 Y250F possibly damaging Het
Fam92a T A 4: 12,171,216 D79V probably damaging Het
Faxc T C 4: 21,958,439 probably benign Het
Frem3 G T 8: 80,695,337 C2122F possibly damaging Het
Gan T C 8: 117,187,499 probably null Het
Gm11487 A G 4: 73,403,058 I154T possibly damaging Het
Hook3 T C 8: 26,038,098 E588G probably damaging Het
Itpr1 C A 6: 108,386,853 S812Y possibly damaging Het
Kbtbd3 C T 9: 4,317,075 probably benign Het
Macf1 C T 4: 123,371,918 A4821T probably damaging Het
Mepe T C 5: 104,327,091 S13P possibly damaging Het
Myh11 A G 16: 14,232,668 Y478H probably damaging Het
Myo7b A G 18: 31,984,960 V871A probably benign Het
Nckap1 A T 2: 80,535,518 M466K probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1025-ps1 A C 2: 85,918,770 S282R probably damaging Het
Olfr1107 T A 2: 87,071,553 N194Y possibly damaging Het
Olfr1413 A T 1: 92,573,767 T199S probably damaging Het
Olfr582 A T 7: 103,041,524 H15L probably benign Het
Olfr731 A G 14: 50,237,949 I312T probably benign Het
Olfr825 A G 10: 130,162,735 I197T probably benign Het
Otof T C 5: 30,421,014 T97A probably benign Het
Peli2 G A 14: 48,256,145 E275K probably benign Het
Pik3c2a T C 7: 116,350,822 Y1320C probably damaging Het
Pkn1 A G 8: 83,671,378 V795A probably damaging Het
Pramel5 A G 4: 144,271,704 L323P probably damaging Het
Prr5 A T 15: 84,701,379 R183W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rabgef1 A G 5: 130,208,779 D231G possibly damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rc3h1 C T 1: 160,954,937 P662L probably benign Het
Rpl7a-ps5 G T 17: 57,839,095 Q47K probably benign Het
Sclt1 G A 3: 41,730,888 T45I probably benign Het
Slc22a17 A G 14: 54,908,086 I202T probably damaging Het
Slc25a13 A G 6: 6,073,487 L457S probably damaging Het
Slc44a3 T C 3: 121,463,410 probably benign Het
Slc7a9 G A 7: 35,454,137 V188M probably damaging Het
Tmem161a T A 8: 70,177,520 F119I probably damaging Het
Tmem240 A G 4: 155,735,435 D32G possibly damaging Het
Tmtc4 T C 14: 122,921,265 N682S probably benign Het
Uqcrc1 G A 9: 108,947,015 V262M probably benign Het
Vmn1r87 G A 7: 13,131,896 R155C probably damaging Het
Vmn2r100 A T 17: 19,522,072 Q236L probably benign Het
Vmn2r97 T A 17: 18,929,682 I444N unknown Het
Wisp1 A G 15: 66,917,409 E248G possibly damaging Het
Yif1a A T 19: 5,089,872 H115L probably damaging Het
Zfp280b T C 10: 76,038,494 L69S probably damaging Het
Zfp579 C A 7: 4,993,521 E464* probably null Het
Other mutations in Gnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02956:Gnl1 APN 17 35987612 missense probably benign
IGL03325:Gnl1 APN 17 35988656 missense probably damaging 1.00
R0648:Gnl1 UTSW 17 35982598 missense probably damaging 1.00
R1611:Gnl1 UTSW 17 35987549 missense probably damaging 1.00
R1781:Gnl1 UTSW 17 35987746 missense probably damaging 1.00
R1897:Gnl1 UTSW 17 35988692 missense possibly damaging 0.73
R2240:Gnl1 UTSW 17 35982679 missense probably benign 0.04
R3944:Gnl1 UTSW 17 35988521 missense probably benign 0.09
R4569:Gnl1 UTSW 17 35988250 missense probably benign 0.00
R4849:Gnl1 UTSW 17 35987711 splice site probably null
R4969:Gnl1 UTSW 17 35980689 missense possibly damaging 0.62
R5661:Gnl1 UTSW 17 35982555 missense probably benign 0.13
R5705:Gnl1 UTSW 17 35981600 missense probably benign 0.01
R6372:Gnl1 UTSW 17 35982535 missense probably damaging 1.00
R6520:Gnl1 UTSW 17 35982953 missense probably benign 0.17
R6919:Gnl1 UTSW 17 35987533 nonsense probably null
R7022:Gnl1 UTSW 17 35988728 missense probably damaging 1.00
R7323:Gnl1 UTSW 17 35983413 missense probably benign 0.01
X0027:Gnl1 UTSW 17 35987801 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCAGAGAAGGTGTTGGCG -3'
(R):5'- TTCCCACCATCTGGCGAG -3'

Sequencing Primer
(F):5'- AGAAGGTGTTGGCGGGTGTG -3'
(R):5'- ACCATCTGGCGAGGGGTG -3'
Posted On2014-08-25