Incidental Mutation 'R1971:Bcl9l'
ID220891
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationunclassified (3088 bp from exon)
DNA Base Change (assembly) T to C at 44508699 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062215] [ENSMUST00000074989] [ENSMUST00000179828] [ENSMUST00000215293] [ENSMUST00000218183] [ENSMUST00000220303]
Predicted Effect probably null
Transcript: ENSMUST00000062215
SMART Domains Protein: ENSMUSP00000050444
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 8.9e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074989
AA Change: I1134T

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: I1134T

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179828
SMART Domains Protein: ENSMUSP00000137518
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 1.7e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215293
Predicted Effect possibly damaging
Transcript: ENSMUST00000218183
AA Change: I1134T

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000220303
AA Change: I1097T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 unclassified probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0227:Bcl9l UTSW 9 44505236 missense possibly damaging 0.96
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5572:Bcl9l UTSW 9 44500798 missense possibly damaging 0.66
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6682:Bcl9l UTSW 9 44501103 missense possibly damaging 0.91
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
R7171:Bcl9l UTSW 9 44505151 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGGCTTCTGCATGCTTCTATAG -3'
(R):5'- CTGGGGCCATCATCATTGAG -3'

Sequencing Primer
(F):5'- ATGCTTCTATAGTCTCTGCTCATGGG -3'
(R):5'- CATTGAGTTTTGAGAAGAGCCCCC -3'
Posted On2014-08-25