Incidental Mutation 'R0138:Abca4'
ID22090
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 038423-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122105449 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 693 (N693K)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: N693K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: N693K

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Meta Mutation Damage Score 0.208 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense not run
Predicted Primers PCR Primer
(F):5'- TGTCCAGAACGGCTCCATTTTGC -3'
(R):5'- GAATTGAGGGTGCTGGCTCTCTAAG -3'

Sequencing Primer
(F):5'- TTGATTCTACCAGGGACAGC -3'
(R):5'- AGCGTCAGGAGGAAGATACT -3'
Posted On2013-04-12