Incidental Mutation 'R1971:Vps54'
ID220915
Institutional Source Beutler Lab
Gene Symbol Vps54
Ensembl Gene ENSMUSG00000020128
Gene NameVPS54 GARP complex subunit
Synonyms5330404P15Rik, wr, mSLP8, Vps54l
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location21239281-21321136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21292051 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 389 (L389I)
Ref Sequence ENSEMBL: ENSMUSP00000006221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006221] [ENSMUST00000109578] [ENSMUST00000132017]
PDB Structure
C-terminal domain of Vps54 subunit of the GARP complex [X-RAY DIFFRACTION]
Vps54 C-terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000006221
AA Change: L389I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006221
Gene: ENSMUSG00000020128
AA Change: L389I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 198 364 2.1e-12 PFAM
Pfam:Vps54 736 868 3.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109578
AA Change: L377I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105206
Gene: ENSMUSG00000020128
AA Change: L377I

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:DUF2450 186 352 2.3e-12 PFAM
Pfam:Vps54 723 857 1.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120479
Predicted Effect probably benign
Transcript: ENSMUST00000132017
SMART Domains Protein: ENSMUSP00000116739
Gene: ENSMUSG00000020128

DomainStartEndE-ValueType
Pfam:DUF2450 72 238 1.4e-12 PFAM
Pfam:Vps54 573 707 7.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132146
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes for a protein that in yeast forms part of a trimeric vacuolar-protein-sorting complex that is required for retrograde transport of proteins from prevacuoles to the late Golgi compartment. As in yeast, mammalian Vps54 proteins contain a coiled-coil region and dileucine motifs. Alternative splicing results in multiple transcript variants encoding different isoforms [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show progressive ataxia, tremors, and limb paralysis with degeneration of motor nerve cells of brainstem and spinal cord and atrophy of skeletal muscle beginning about 3-weeks of age. Mutants are sterile and most die by 3-months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Vps54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Vps54 APN 11 21277909 missense possibly damaging 0.74
IGL01070:Vps54 APN 11 21312268 missense probably damaging 1.00
IGL01398:Vps54 APN 11 21295403 splice site probably benign
IGL01450:Vps54 APN 11 21291135 missense probably benign 0.00
IGL01611:Vps54 APN 11 21311082 missense probably damaging 1.00
IGL01801:Vps54 APN 11 21275131 critical splice donor site probably null
IGL01872:Vps54 APN 11 21306940 missense probably damaging 0.99
IGL02071:Vps54 APN 11 21275071 missense probably null 0.00
IGL02186:Vps54 APN 11 21306947 missense probably damaging 1.00
IGL03358:Vps54 APN 11 21268799 missense probably damaging 1.00
R0031:Vps54 UTSW 11 21312899 missense probably damaging 1.00
R0147:Vps54 UTSW 11 21300259 missense probably benign 0.02
R0158:Vps54 UTSW 11 21306962 missense probably damaging 1.00
R0385:Vps54 UTSW 11 21306381 missense possibly damaging 0.94
R0420:Vps54 UTSW 11 21311071 splice site probably benign
R0582:Vps54 UTSW 11 21300137 missense probably damaging 1.00
R0602:Vps54 UTSW 11 21306434 missense possibly damaging 0.92
R1051:Vps54 UTSW 11 21278001 frame shift probably null
R1280:Vps54 UTSW 11 21277868 missense possibly damaging 0.88
R1720:Vps54 UTSW 11 21306519 missense probably damaging 1.00
R1875:Vps54 UTSW 11 21300251 missense probably benign 0.00
R1883:Vps54 UTSW 11 21312967 missense possibly damaging 0.91
R2063:Vps54 UTSW 11 21277955 missense probably damaging 1.00
R2171:Vps54 UTSW 11 21298810 missense probably benign 0.16
R2518:Vps54 UTSW 11 21306394 missense probably benign 0.01
R3801:Vps54 UTSW 11 21268832 missense probably benign 0.00
R4049:Vps54 UTSW 11 21300183 missense probably benign 0.00
R4108:Vps54 UTSW 11 21312877 missense probably benign 0.02
R4560:Vps54 UTSW 11 21312260 missense possibly damaging 0.91
R4668:Vps54 UTSW 11 21299989 missense probably benign 0.04
R4772:Vps54 UTSW 11 21312952 missense probably damaging 1.00
R5061:Vps54 UTSW 11 21319881 utr 3 prime probably benign
R5611:Vps54 UTSW 11 21311130 missense possibly damaging 0.65
R5638:Vps54 UTSW 11 21308799 missense probably damaging 1.00
R5670:Vps54 UTSW 11 21264864 missense probably damaging 1.00
R7095:Vps54 UTSW 11 21271720 missense probably benign 0.12
R7175:Vps54 UTSW 11 21315028 critical splice donor site probably null
R7179:Vps54 UTSW 11 21298791 missense probably damaging 1.00
R7286:Vps54 UTSW 11 21275005 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAGGGGTCACATCATACTTCTG -3'
(R):5'- AAGTAGTGGTCCTGGCTGCTAG -3'

Sequencing Primer
(F):5'- GGGTCACATCATACTTCTGGAAGC -3'
(R):5'- TGACCAAGTATTACTATTATGCTGC -3'
Posted On2014-08-25