Incidental Mutation 'R0138:Dnaic1'
ID22092
Institutional Source Beutler Lab
Gene Symbol Dnaic1
Ensembl Gene ENSMUSG00000061322
Gene Namedynein, axonemal, intermediate chain 1
Synonyms
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location41569775-41638158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41629814 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 446 (M446K)
Ref Sequence ENSEMBL: ENSMUSP00000100028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102963] [ENSMUST00000119127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102963
AA Change: M446K

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100028
Gene: ENSMUSG00000061322
AA Change: M446K

DomainStartEndE-ValueType
low complexity region 134 158 N/A INTRINSIC
low complexity region 238 261 N/A INTRINSIC
Blast:WD40 319 370 1e-17 BLAST
WD40 374 413 1.5e-3 SMART
WD40 419 465 4.4e-2 SMART
Blast:WD40 493 526 5e-13 BLAST
WD40 530 570 9.3e-9 SMART
WD40 575 612 6e-3 SMART
WD40 623 659 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119127
SMART Domains Protein: ENSMUSP00000113929
Gene: ENSMUSG00000061322

DomainStartEndE-ValueType
Blast:WD40 16 53 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143198
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dynein intermediate chain family. The encoded protein is part of the dynein complex in respiratory cilia. The inner- and outer-arm dyneins, which bridge between the doublet microtubules in axonemes, are the force-generating proteins responsible for the sliding movement in axonemes. The intermediate and light chains, thought to form the base of the dynein arm, help mediate attachment and may also participate in regulating dynein activity. Mutations in this gene result in abnormal ciliary ultrastructure and function associated with primary ciliary dyskinesia and Kartagener syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutant mice exhibit situs inversus, heterotaxia and ciliary dyskinesia including cardiovascular defects and decreased ciliary activity in the trachea, reduced to absent mucociliary clearance, and chronic rhinosinusitis. Hydrocephaly is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Dnaic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02678:Dnaic1 APN 4 41602917 missense probably benign 0.03
IGL02825:Dnaic1 APN 4 41625101 splice site probably benign
IGL03072:Dnaic1 APN 4 41602979 missense probably benign 0.00
H8562:Dnaic1 UTSW 4 41629833 missense possibly damaging 0.81
R0114:Dnaic1 UTSW 4 41605686 splice site probably benign
R0153:Dnaic1 UTSW 4 41635162 unclassified probably benign
R0465:Dnaic1 UTSW 4 41629988 unclassified probably null
R0550:Dnaic1 UTSW 4 41596274 nonsense probably null
R0555:Dnaic1 UTSW 4 41625335 missense possibly damaging 0.64
R0890:Dnaic1 UTSW 4 41604253 missense possibly damaging 0.69
R0928:Dnaic1 UTSW 4 41602566 missense possibly damaging 0.57
R0944:Dnaic1 UTSW 4 41629997 missense probably benign
R1714:Dnaic1 UTSW 4 41632164 missense probably benign 0.12
R1902:Dnaic1 UTSW 4 41625319 nonsense probably null
R1919:Dnaic1 UTSW 4 41570020 critical splice donor site probably null
R1983:Dnaic1 UTSW 4 41603232 missense probably benign
R2036:Dnaic1 UTSW 4 41632225 missense probably damaging 1.00
R2306:Dnaic1 UTSW 4 41625239 missense probably benign
R2925:Dnaic1 UTSW 4 41597919 missense probably damaging 1.00
R3404:Dnaic1 UTSW 4 41603246 missense probably benign 0.00
R3720:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3721:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3722:Dnaic1 UTSW 4 41602615 missense probably damaging 1.00
R3931:Dnaic1 UTSW 4 41604229 missense probably damaging 1.00
R4330:Dnaic1 UTSW 4 41637966 missense probably damaging 1.00
R4755:Dnaic1 UTSW 4 41610269 missense probably damaging 0.99
R4905:Dnaic1 UTSW 4 41614269 missense probably benign 0.05
R4997:Dnaic1 UTSW 4 41597919 missense possibly damaging 0.80
R5088:Dnaic1 UTSW 4 41597630 missense probably benign 0.00
R5088:Dnaic1 UTSW 4 41632251 missense probably benign 0.02
R5970:Dnaic1 UTSW 4 41625281 missense probably benign 0.14
R5987:Dnaic1 UTSW 4 41632391 missense probably benign 0.03
R6247:Dnaic1 UTSW 4 41605775 missense probably benign
R6727:Dnaic1 UTSW 4 41625308 missense probably benign
R6874:Dnaic1 UTSW 4 41632412 missense probably damaging 1.00
R6914:Dnaic1 UTSW 4 41625176 missense probably benign 0.01
R7508:Dnaic1 UTSW 4 41614323 missense probably benign 0.01
X0065:Dnaic1 UTSW 4 41629868 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAAGTATTTGCCACCATGCCTGG -3'
(R):5'- CTCCTACCTACAGTGTGCAACTGC -3'

Sequencing Primer
(F):5'- ccatgcctggcCCCATTAG -3'
(R):5'- TGTCGATGTGAACCAGCTC -3'
Posted On2013-04-12