Incidental Mutation 'R1971:Ush1g'
ID220933
Institutional Source Beutler Lab
Gene Symbol Ush1g
Ensembl Gene ENSMUSG00000045288
Gene NameUSH1 protein network component sans
Synonymsjs, Sans
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115315192-115322041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115318454 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000099326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000103037] [ENSMUST00000106544]
Predicted Effect probably benign
Transcript: ENSMUST00000055490
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103037
AA Change: S305P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099326
Gene: ENSMUSG00000045288
AA Change: S305P

DomainStartEndE-ValueType
ANK 31 60 1.83e-3 SMART
ANK 64 93 8.07e-5 SMART
ANK 97 126 6.26e-2 SMART
low complexity region 159 190 N/A INTRINSIC
PDB:3PVL|B 295 368 3e-30 PDB
SAM 385 449 1.34e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106544
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139466
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with combined auditory and vision loss. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutant homozygotes exhibit hyperactivity, head-tossing, circling behavior and profound deafness. Structurally, mutants display disorganized stereocilia of outer ear hair cells and degeneration of inner ear neuroepithelia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Ush1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01961:Ush1g APN 11 115318535 missense probably benign 0.00
IGL02055:Ush1g APN 11 115318099 missense possibly damaging 0.94
R0833:Ush1g UTSW 11 115318868 missense possibly damaging 0.71
R1435:Ush1g UTSW 11 115318468 missense probably damaging 1.00
R1969:Ush1g UTSW 11 115318454 missense probably damaging 1.00
R3546:Ush1g UTSW 11 115318897 missense probably damaging 1.00
R4789:Ush1g UTSW 11 115318640 missense probably damaging 1.00
R5074:Ush1g UTSW 11 115318297 missense possibly damaging 0.94
R5882:Ush1g UTSW 11 115318542 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCTAGCTCATCCCAGGG -3'
(R):5'- TTCAAGGTCTCTGAGGACGG -3'

Sequencing Primer
(F):5'- TCCTGCAAGCTGTTGGCAC -3'
(R):5'- CGCAAAAGCGTCCGATCG -3'
Posted On2014-08-25