Incidental Mutation 'R1971:Foxp4'
ID220982
Institutional Source Beutler Lab
Gene Symbol Foxp4
Ensembl Gene ENSMUSG00000023991
Gene Nameforkhead box P4
Synonyms
MMRRC Submission 039984-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R1971 (G1)
Quality Score144
Status Not validated
Chromosome17
Chromosomal Location47867133-47924645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47875871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 378 (R378Q)
Ref Sequence ENSEMBL: ENSMUSP00000108890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097311] [ENSMUST00000113262] [ENSMUST00000113263] [ENSMUST00000113265]
Predicted Effect unknown
Transcript: ENSMUST00000097311
AA Change: R379Q
SMART Domains Protein: ENSMUSP00000094916
Gene: ENSMUSG00000023991
AA Change: R379Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 470 552 4.69e-38 SMART
low complexity region 644 658 N/A INTRINSIC
low complexity region 671 683 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113262
AA Change: R379Q
SMART Domains Protein: ENSMUSP00000108887
Gene: ENSMUSG00000023991
AA Change: R379Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 297 308 N/A INTRINSIC
ZnF_C2H2 313 338 3.47e0 SMART
FH 458 540 4.69e-38 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 659 671 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113263
AA Change: R377Q
SMART Domains Protein: ENSMUSP00000108888
Gene: ENSMUSG00000023991
AA Change: R377Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 171 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
ZnF_C2H2 311 336 3.47e0 SMART
FH 468 550 4.69e-38 SMART
low complexity region 642 656 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113265
AA Change: R378Q
SMART Domains Protein: ENSMUSP00000108890
Gene: ENSMUSG00000023991
AA Change: R378Q

DomainStartEndE-ValueType
low complexity region 27 46 N/A INTRINSIC
low complexity region 67 87 N/A INTRINSIC
low complexity region 100 173 N/A INTRINSIC
low complexity region 182 208 N/A INTRINSIC
internal_repeat_1 214 282 3.94e-5 PROSPERO
low complexity region 296 307 N/A INTRINSIC
ZnF_C2H2 312 337 3.47e0 SMART
FH 457 539 4.69e-38 SMART
internal_repeat_1 571 627 3.94e-5 PROSPERO
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154108
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Many members of the forkhead box gene family, including members of subfamily P, have roles in mammalian oncogenesis. This gene may play a role in the development of tumors of the kidney and larynx. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die before E12.5. Foregut closure is delayed leading to the development of two beating hearts and to the failure of the trachea and esophagus to separate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tbc1d9 G A 8: 83,249,510 R566H probably damaging Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Foxp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Foxp4 APN 17 47888153 missense probably damaging 1.00
IGL02454:Foxp4 APN 17 47875582 nonsense probably null
IGL03048:Foxp4 UTSW 17 47880840 missense unknown
R0138:Foxp4 UTSW 17 47869179 missense unknown
R1180:Foxp4 UTSW 17 47880353 splice site probably benign
R1268:Foxp4 UTSW 17 47880353 splice site probably benign
R1282:Foxp4 UTSW 17 47875643 missense unknown
R1494:Foxp4 UTSW 17 47880353 splice site probably benign
R1845:Foxp4 UTSW 17 47877959 missense probably null
R1956:Foxp4 UTSW 17 47875871 missense unknown
R1958:Foxp4 UTSW 17 47875871 missense unknown
R1969:Foxp4 UTSW 17 47875871 missense unknown
R1970:Foxp4 UTSW 17 47875871 missense unknown
R2240:Foxp4 UTSW 17 47871276 missense unknown
R3847:Foxp4 UTSW 17 47875528 missense unknown
R3848:Foxp4 UTSW 17 47875528 missense unknown
R3849:Foxp4 UTSW 17 47875528 missense unknown
R4345:Foxp4 UTSW 17 47874648 missense unknown
R5572:Foxp4 UTSW 17 47880879 missense unknown
R5726:Foxp4 UTSW 17 47869108 missense unknown
R6386:Foxp4 UTSW 17 47878462 missense unknown
R6510:Foxp4 UTSW 17 47875410 missense unknown
X0025:Foxp4 UTSW 17 47877965 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGGTCACCTTGGAGAATGAG -3'
(R):5'- AGGTATGTGCGTGCATATGC -3'

Sequencing Primer
(F):5'- CCTTGGAGAATGAGGAGGAGCC -3'
(R):5'- ATGCACAAGTGTGTATGTGTG -3'
Posted On2014-08-25