Incidental Mutation 'R2029:Kdm6b'
ID221026
Institutional Source Beutler Lab
Gene Symbol Kdm6b
Ensembl Gene ENSMUSG00000018476
Gene NameKDM1 lysine (K)-specific demethylase 6B
SynonymsJmjd3
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69398508-69413675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69403592 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1218 (G1218D)
Ref Sequence ENSEMBL: ENSMUSP00000091620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094077]
PDB Structure
The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000094077
AA Change: G1218D
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: G1218D

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156562
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Kdm6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Kdm6b APN 11 69406306 missense possibly damaging 0.85
IGL02271:Kdm6b APN 11 69406067 missense possibly damaging 0.65
Ostentatious UTSW 11 69403598 missense unknown
PIT4458001:Kdm6b UTSW 11 69399952 missense unknown
R0455:Kdm6b UTSW 11 69406996 nonsense probably null
R0645:Kdm6b UTSW 11 69405018 missense unknown
R1659:Kdm6b UTSW 11 69407588 missense possibly damaging 0.88
R1855:Kdm6b UTSW 11 69407286 missense probably damaging 0.99
R1962:Kdm6b UTSW 11 69401365 unclassified probably benign
R1993:Kdm6b UTSW 11 69406303 missense probably null 0.85
R2181:Kdm6b UTSW 11 69401126 nonsense probably null
R2215:Kdm6b UTSW 11 69405044 missense unknown
R2904:Kdm6b UTSW 11 69405785 missense possibly damaging 0.63
R2992:Kdm6b UTSW 11 69406307 small deletion probably benign
R3236:Kdm6b UTSW 11 69406366 missense probably damaging 1.00
R3950:Kdm6b UTSW 11 69405615 missense probably damaging 1.00
R4027:Kdm6b UTSW 11 69406268 missense possibly damaging 0.92
R4830:Kdm6b UTSW 11 69403794 missense unknown
R4996:Kdm6b UTSW 11 69405731 missense probably damaging 1.00
R5034:Kdm6b UTSW 11 69401910 splice site probably benign
R5140:Kdm6b UTSW 11 69400055 unclassified probably benign
R5160:Kdm6b UTSW 11 69400768 unclassified probably benign
R5240:Kdm6b UTSW 11 69401904 splice site probably benign
R5273:Kdm6b UTSW 11 69404201 missense unknown
R5386:Kdm6b UTSW 11 69400810 unclassified probably benign
R5597:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5598:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5812:Kdm6b UTSW 11 69405929 missense probably damaging 0.98
R5976:Kdm6b UTSW 11 69403788 critical splice donor site probably null
R6000:Kdm6b UTSW 11 69403598 missense unknown
R6145:Kdm6b UTSW 11 69405026 missense unknown
R6191:Kdm6b UTSW 11 69406758 missense probably benign 0.01
R6256:Kdm6b UTSW 11 69406729 missense probably damaging 0.96
R6304:Kdm6b UTSW 11 69404258 missense unknown
R6917:Kdm6b UTSW 11 69406593 missense probably benign 0.04
R6939:Kdm6b UTSW 11 69406762 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGTCTATTTCCCATGTGTCCAC -3'
(R):5'- AGAGCCACCCTTTCCAGAAG -3'

Sequencing Primer
(F):5'- AACACCTCAAGGCTGGTTG -3'
(R):5'- CTTTCCAGAAGGGTTGAATTGG -3'
Posted On2014-08-25