Incidental Mutation 'R2029:Zfyve16'
ID221042
Institutional Source Beutler Lab
Gene Symbol Zfyve16
Ensembl Gene ENSMUSG00000021706
Gene Namezinc finger, FYVE domain containing 16
SynonymsB130024H06Rik
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92487108-92530868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92504477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1253 (D1253G)
Ref Sequence ENSEMBL: ENSMUSP00000022217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022217]
Predicted Effect probably damaging
Transcript: ENSMUST00000022217
AA Change: D1253G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: D1253G

DomainStartEndE-ValueType
low complexity region 163 175 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 455 484 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
FYVE 727 794 7.25e-31 SMART
low complexity region 821 838 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
Pfam:DUF3480 1155 1503 3.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156586
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Zfyve16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfyve16 APN 13 92516538 missense possibly damaging 0.56
IGL00737:Zfyve16 APN 13 92521118 nonsense probably null
IGL00741:Zfyve16 APN 13 92524253 missense probably damaging 1.00
IGL00753:Zfyve16 APN 13 92521118 nonsense probably null
IGL01123:Zfyve16 APN 13 92492522 missense probably damaging 1.00
IGL01149:Zfyve16 APN 13 92508283 missense probably damaging 1.00
IGL01414:Zfyve16 APN 13 92522196 missense probably benign 0.04
IGL01771:Zfyve16 APN 13 92522172 missense probably benign 0.38
IGL01889:Zfyve16 APN 13 92522569 missense possibly damaging 0.87
IGL01928:Zfyve16 APN 13 92504498 missense probably damaging 0.97
IGL02524:Zfyve16 APN 13 92504514 missense probably benign 0.19
IGL03102:Zfyve16 APN 13 92511817 missense possibly damaging 0.57
IGL03192:Zfyve16 APN 13 92521240 missense possibly damaging 0.94
PIT4151001:Zfyve16 UTSW 13 92521204 missense probably damaging 0.99
R0321:Zfyve16 UTSW 13 92492534 missense probably damaging 0.99
R0548:Zfyve16 UTSW 13 92494944 missense probably benign 0.00
R0555:Zfyve16 UTSW 13 92516520 splice site probably benign
R0616:Zfyve16 UTSW 13 92521129 missense probably damaging 1.00
R0727:Zfyve16 UTSW 13 92493878 missense possibly damaging 0.81
R0730:Zfyve16 UTSW 13 92521477 missense probably damaging 0.98
R1221:Zfyve16 UTSW 13 92508305 missense possibly damaging 0.87
R1297:Zfyve16 UTSW 13 92522332 missense probably benign 0.41
R1597:Zfyve16 UTSW 13 92508247 missense probably benign 0.02
R1635:Zfyve16 UTSW 13 92509020 missense probably damaging 1.00
R1803:Zfyve16 UTSW 13 92504085 missense probably damaging 1.00
R1840:Zfyve16 UTSW 13 92511525 missense possibly damaging 0.79
R1962:Zfyve16 UTSW 13 92522744 missense possibly damaging 0.74
R2083:Zfyve16 UTSW 13 92524262 missense probably damaging 1.00
R2122:Zfyve16 UTSW 13 92519483 nonsense probably null
R2173:Zfyve16 UTSW 13 92495088 missense probably damaging 0.99
R3822:Zfyve16 UTSW 13 92521261 missense probably damaging 1.00
R3857:Zfyve16 UTSW 13 92494971 missense probably damaging 1.00
R4043:Zfyve16 UTSW 13 92513763 intron probably null
R4056:Zfyve16 UTSW 13 92504549 missense probably damaging 1.00
R4495:Zfyve16 UTSW 13 92488567 missense probably benign 0.25
R4518:Zfyve16 UTSW 13 92521312 missense possibly damaging 0.86
R4835:Zfyve16 UTSW 13 92522185 missense probably benign 0.18
R4862:Zfyve16 UTSW 13 92508256 missense probably damaging 1.00
R4962:Zfyve16 UTSW 13 92513894 missense probably damaging 1.00
R5117:Zfyve16 UTSW 13 92505689 missense possibly damaging 0.95
R5344:Zfyve16 UTSW 13 92521588 missense possibly damaging 0.79
R5358:Zfyve16 UTSW 13 92508263 missense probably benign 0.04
R5407:Zfyve16 UTSW 13 92500284 missense probably damaging 1.00
R5410:Zfyve16 UTSW 13 92521231 missense probably benign 0.08
R5704:Zfyve16 UTSW 13 92504471 splice site probably null
R5731:Zfyve16 UTSW 13 92508193 missense probably benign 0.11
R5808:Zfyve16 UTSW 13 92495055 nonsense probably null
R5828:Zfyve16 UTSW 13 92513902 missense probably damaging 1.00
R5928:Zfyve16 UTSW 13 92522117 missense probably benign 0.01
R6044:Zfyve16 UTSW 13 92522666 nonsense probably null
R6141:Zfyve16 UTSW 13 92511597 missense probably benign 0.00
R6538:Zfyve16 UTSW 13 92504516 missense probably damaging 1.00
R6594:Zfyve16 UTSW 13 92513818 missense probably benign 0.23
R6767:Zfyve16 UTSW 13 92508199 missense probably damaging 1.00
R6942:Zfyve16 UTSW 13 92516631 missense probably benign
R7011:Zfyve16 UTSW 13 92521987 missense probably benign 0.00
R7381:Zfyve16 UTSW 13 92521146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAACCAAGATGGACAGACAGAC -3'
(R):5'- AAGCTGGGACTGTCTTTCTG -3'

Sequencing Primer
(F):5'- GCTGGCAGGAGGTAAAAATCTC -3'
(R):5'- AGCACTTTGATAGGACTGTCAG -3'
Posted On2014-08-25