Incidental Mutation 'R2029:4921501E09Rik'
ID221064
Institutional Source Beutler Lab
Gene Symbol 4921501E09Rik
Ensembl Gene ENSMUSG00000023350
Gene NameRIKEN cDNA 4921501E09 gene
Synonyms
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R2029 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33064143-33068058 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33067624 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 68 (S68*)
Ref Sequence ENSEMBL: ENSMUSP00000024121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024121]
Predicted Effect probably null
Transcript: ENSMUST00000024121
AA Change: S68*
SMART Domains Protein: ENSMUSP00000024121
Gene: ENSMUSG00000023350
AA Change: S68*

DomainStartEndE-ValueType
PHD 7 54 1.5e-8 SMART
JmjC 195 351 1.38e-46 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Ddx3y T C Y: 1,266,389 E331G probably benign Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in 4921501E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:4921501E09Rik APN 17 33065863 missense probably benign 0.10
IGL00790:4921501E09Rik APN 17 33067387 missense probably damaging 1.00
IGL01146:4921501E09Rik APN 17 33065383 missense possibly damaging 0.68
IGL01755:4921501E09Rik APN 17 33066977 missense probably damaging 0.99
IGL01880:4921501E09Rik APN 17 33066716 missense probably damaging 0.99
IGL01981:4921501E09Rik APN 17 33067654 missense probably damaging 1.00
IGL01982:4921501E09Rik APN 17 33066315 missense probably benign 0.00
IGL02047:4921501E09Rik APN 17 33067301 missense probably damaging 1.00
IGL02070:4921501E09Rik APN 17 33066130 missense probably damaging 0.98
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0055:4921501E09Rik UTSW 17 33066722 missense probably damaging 1.00
R0893:4921501E09Rik UTSW 17 33065289 missense probably benign 0.34
R1528:4921501E09Rik UTSW 17 33067241 missense probably damaging 1.00
R1558:4921501E09Rik UTSW 17 33065705 missense probably benign 0.20
R1664:4921501E09Rik UTSW 17 33066518 missense probably damaging 1.00
R1782:4921501E09Rik UTSW 17 33067688 missense probably benign 0.06
R1881:4921501E09Rik UTSW 17 33065284 missense probably damaging 1.00
R2018:4921501E09Rik UTSW 17 33066967 missense probably benign 0.15
R2152:4921501E09Rik UTSW 17 33066934 missense probably damaging 1.00
R2298:4921501E09Rik UTSW 17 33066778 missense probably damaging 1.00
R2395:4921501E09Rik UTSW 17 33065962 missense probably benign 0.28
R2424:4921501E09Rik UTSW 17 33065756 missense probably benign 0.00
R3973:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R3976:4921501E09Rik UTSW 17 33066431 missense probably benign 0.24
R4159:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4160:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4161:4921501E09Rik UTSW 17 33066049 missense probably benign 0.01
R4761:4921501E09Rik UTSW 17 33067198 missense probably damaging 1.00
R4855:4921501E09Rik UTSW 17 33066739 missense probably benign 0.00
R5039:4921501E09Rik UTSW 17 33067760 missense probably damaging 1.00
R5255:4921501E09Rik UTSW 17 33066765 nonsense probably null
R5383:4921501E09Rik UTSW 17 33065257 missense probably benign
R5520:4921501E09Rik UTSW 17 33065393 missense probably benign 0.03
R5588:4921501E09Rik UTSW 17 33066275 nonsense probably null
R5685:4921501E09Rik UTSW 17 33066772 missense probably benign 0.04
R5826:4921501E09Rik UTSW 17 33065314 missense possibly damaging 0.87
R5907:4921501E09Rik UTSW 17 33066150 missense probably benign 0.01
R6397:4921501E09Rik UTSW 17 33066245 missense probably benign 0.28
R6731:4921501E09Rik UTSW 17 33066226 missense probably benign 0.02
R6750:4921501E09Rik UTSW 17 33066398 missense possibly damaging 0.82
R7043:4921501E09Rik UTSW 17 33065332 missense possibly damaging 0.85
R7242:4921501E09Rik UTSW 17 33067127 missense probably damaging 1.00
R7262:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7265:4921501E09Rik UTSW 17 33066997 missense probably damaging 0.99
R7286:4921501E09Rik UTSW 17 33065527 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCGGTGGAAGTGTCATCC -3'
(R):5'- TGTATTGTCTTTGTCGACAGCC -3'

Sequencing Primer
(F):5'- GTGGAAGTGTCATCCCCAAC -3'
(R):5'- GTCGACAGCCTTATAATGTGAACC -3'
Posted On2014-08-25