Incidental Mutation 'R2029:Ddx3y'
ID221082
Institutional Source Beutler Lab
Gene Symbol Ddx3y
Ensembl Gene ENSMUSG00000069045
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked
SynonymsDby, D1Pas1-rs1, 8030469F12Rik
MMRRC Submission 040036-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R2029 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1260771-1286629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1266389 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 331 (E331G)
Ref Sequence ENSEMBL: ENSMUSP00000088729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091190] [ENSMUST00000188484]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084813
Predicted Effect probably benign
Transcript: ENSMUST00000091190
AA Change: E331G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088729
Gene: ENSMUSG00000069045
AA Change: E331G

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
DEXDc 198 417 3.39e-65 SMART
HELICc 454 535 2.61e-34 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 603 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188182
Predicted Effect probably benign
Transcript: ENSMUST00000188484
Meta Mutation Damage Score 0.2416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G T 17: 33,067,624 S68* probably null Het
9130409I23Rik T A 1: 181,054,931 I86K probably benign Het
Adam18 C G 8: 24,650,877 G286A probably damaging Het
Adcy1 G A 11: 7,139,142 A519T probably benign Het
AI314180 G A 4: 58,844,165 R534* probably null Het
Anxa2 T A 9: 69,464,480 S2T possibly damaging Het
Ap3m1 G A 14: 21,039,149 S261L possibly damaging Het
Asna1 A T 8: 85,019,774 Y148* probably null Het
Baz2b A T 2: 59,912,723 probably benign Het
Brdt T A 5: 107,359,224 S497T probably benign Het
Cdh11 A G 8: 102,679,772 F23S probably benign Het
Cdh16 A C 8: 104,617,802 L540R probably damaging Het
Ces5a A T 8: 93,534,577 L74Q probably damaging Het
Cfap69 A G 5: 5,604,306 S543P probably damaging Het
Cfap74 T C 4: 155,442,081 I763T possibly damaging Het
Cma1 T A 14: 55,943,734 R58S possibly damaging Het
Csmd3 C T 15: 47,838,579 D1599N probably damaging Het
Cyld A G 8: 88,745,312 K857R probably benign Het
Cyp3a16 T C 5: 145,451,857 D270G probably damaging Het
D1Pas1 T C 1: 186,968,089 S72P possibly damaging Het
Dis3l2 T C 1: 86,854,467 probably benign Het
Dopey1 G T 9: 86,521,365 W1539C probably damaging Het
Dopey2 A G 16: 93,769,435 K917E probably benign Het
Efcab3 T C 11: 105,100,025 I5462T probably damaging Het
Epo A G 5: 137,485,185 probably benign Het
Figla T A 6: 86,020,642 probably benign Het
Flvcr1 T C 1: 191,021,156 D273G probably benign Het
Fryl T A 5: 73,022,122 R304* probably null Het
Gcm1 T G 9: 78,065,044 D422E possibly damaging Het
Ggt6 A G 11: 72,437,541 D251G possibly damaging Het
Git2 A G 5: 114,766,450 probably null Het
Gm18856 A T 13: 13,964,791 probably benign Het
Gm20939 T A 17: 94,875,824 probably benign Het
Gm5039 A T 12: 88,321,421 S21T unknown Het
Gm7534 T C 4: 134,202,358 K212R possibly damaging Het
Gpr176 A G 2: 118,279,432 Y449H probably benign Het
H2-Eb1 A G 17: 34,314,392 E196G probably damaging Het
H2-M10.6 A G 17: 36,813,907 T239A possibly damaging Het
Haus5 T C 7: 30,659,400 N237S possibly damaging Het
Hectd3 T C 4: 117,000,685 M605T probably damaging Het
Hps3 T C 3: 20,030,527 I166V probably benign Het
Ighv5-21 A T 12: 114,322,814 probably benign Het
Kdm6b C T 11: 69,403,592 G1218D unknown Het
Klhl30 A G 1: 91,357,914 probably null Het
Kmt2a A T 9: 44,818,450 S3523R probably benign Het
Lnpep A T 17: 17,568,399 N481K probably damaging Het
Lrp1b T C 2: 41,341,849 H1203R probably benign Het
Lrrc8a C T 2: 30,256,649 R492W probably damaging Het
Magel2 T A 7: 62,380,594 V1082D unknown Het
Memo1 A C 17: 74,245,054 H82Q probably null Het
Myh13 A T 11: 67,361,289 T1408S probably benign Het
Myh2 A T 11: 67,194,625 N1792Y possibly damaging Het
Myo1e A T 9: 70,368,687 N728I possibly damaging Het
Myo1e T C 9: 70,378,715 probably benign Het
Myo5c T C 9: 75,289,055 probably benign Het
Olfr1205 T A 2: 88,831,405 M96K possibly damaging Het
Olfr323 T A 11: 58,625,493 L184F probably damaging Het
Olfr378 A G 11: 73,425,362 V207A probably benign Het
Olfr578 T A 7: 102,984,271 T298S probably damaging Het
Olfr594 T C 7: 103,219,760 F14S probably damaging Het
Olfr715b T C 7: 107,106,436 I142V probably benign Het
Parp2 C T 14: 50,810,086 A18V probably benign Het
Peli1 T A 11: 21,148,110 C282S probably damaging Het
Piezo2 T C 18: 63,118,935 M404V possibly damaging Het
Pkn1 T A 8: 83,677,963 Q496L possibly damaging Het
Pla2r1 A T 2: 60,431,973 F1093L probably damaging Het
Ppp2r3a A G 9: 101,145,481 V323A probably damaging Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prg2 C T 2: 84,981,998 probably benign Het
Ptprb G A 10: 116,347,053 G1545S probably benign Het
Rbm19 A G 5: 120,120,242 D174G possibly damaging Het
Rhbdf2 T A 11: 116,601,148 T526S probably damaging Het
Rpusd4 A G 9: 35,268,014 N42S probably benign Het
Ryr3 T A 2: 112,647,016 Q4455L possibly damaging Het
Sema4a G T 3: 88,451,361 H30Q probably damaging Het
Skint1 G A 4: 112,021,456 probably null Het
Slc1a3 A G 15: 8,645,669 V284A probably benign Het
Slc30a9 A T 5: 67,339,975 K288* probably null Het
Slc36a1 G T 11: 55,228,338 A380S probably benign Het
Slc47a1 G A 11: 61,378,007 probably benign Het
Snx19 A T 9: 30,429,000 E478V probably benign Het
Spag6 T C 2: 18,734,105 probably benign Het
Stag1 A T 9: 100,786,687 T223S probably damaging Het
Terb1 A T 8: 104,498,100 probably benign Het
Terf1 A G 1: 15,805,946 D90G possibly damaging Het
Tex15 A G 8: 33,571,274 D518G probably damaging Het
Tmem174 T A 13: 98,637,038 M95L possibly damaging Het
Tnnt3 GTCCAGGCATCTC GTC 7: 142,512,627 probably benign Het
Usp28 A G 9: 48,985,503 D8G probably benign Het
Vmn2r105 T C 17: 20,224,578 T551A probably damaging Het
Vmn2r107 A G 17: 20,375,287 I701V probably benign Het
Vmn2r13 A C 5: 109,192,077 F11V probably benign Het
Vmn2r85 G C 10: 130,425,574 S298* probably null Het
Wdr6 C G 9: 108,575,355 W443S probably damaging Het
Wipi1 A G 11: 109,583,190 V210A probably damaging Het
Zfp317 A G 9: 19,645,236 T47A probably benign Het
Zfp61 T C 7: 24,292,289 T146A probably benign Het
Zfp964 A G 8: 69,663,917 E389G unknown Het
Zfyve16 T C 13: 92,504,477 D1253G probably damaging Het
Zswim7 G A 11: 62,267,473 probably benign Het
Other mutations in Ddx3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03134:Ddx3y UTSW Y 1278949 missense possibly damaging 0.93
R0326:Ddx3y UTSW Y 1263321 nonsense probably null
R1755:Ddx3y UTSW Y 1279543 missense probably benign 0.00
R2076:Ddx3y UTSW Y 1266593 critical splice donor site probably null
R3610:Ddx3y UTSW Y 1263928 missense probably null 1.00
R3973:Ddx3y UTSW Y 1267170 missense probably damaging 1.00
R5041:Ddx3y UTSW Y 1266611 missense probably benign 0.05
R5396:Ddx3y UTSW Y 1265965 missense probably damaging 1.00
R6266:Ddx3y UTSW Y 1266635 missense probably damaging 1.00
R6473:Ddx3y UTSW Y 1265971 missense possibly damaging 0.93
R7048:Ddx3y UTSW Y 1279491 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGACTACATGAAGAGGTCC -3'
(R):5'- TGCAGATCTATGAGGAAGCCAG -3'

Sequencing Primer
(F):5'- AGAGGTCCCATTTAATGAGCC -3'
(R):5'- GCCAGAAAAGTAAGCATAGCC -3'
Posted On2014-08-25