Incidental Mutation 'R2030:Ak2'
ID221116
Institutional Source Beutler Lab
Gene Symbol Ak2
Ensembl Gene ENSMUSG00000028792
Gene Nameadenylate kinase 2
SynonymsD4Ertd220e, Ak-2
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location128991958-129011529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129008220 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 229 (K229E)
Ref Sequence ENSEMBL: ENSMUSP00000099664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030583] [ENSMUST00000102604] [ENSMUST00000152762]
Predicted Effect probably benign
Transcript: ENSMUST00000030583
AA Change: K229E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030583
Gene: ENSMUSG00000028792
AA Change: K229E

DomainStartEndE-ValueType
Pfam:ADK 20 206 2.2e-62 PFAM
Pfam:ADK_lid 142 177 4.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102604
AA Change: K229E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099664
Gene: ENSMUSG00000028792
AA Change: K229E

DomainStartEndE-ValueType
Pfam:ADK 20 206 2.3e-62 PFAM
Pfam:ADK_lid 142 177 9.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152762
SMART Domains Protein: ENSMUSP00000122284
Gene: ENSMUSG00000028792

DomainStartEndE-ValueType
Pfam:ADK 17 72 9.3e-26 PFAM
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Ak2 APN 4 128999237 missense probably benign 0.01
IGL03068:Ak2 APN 4 129008026 splice site probably benign
R0587:Ak2 UTSW 4 129002378 missense probably damaging 1.00
R1464:Ak2 UTSW 4 129002359 splice site probably benign
R1727:Ak2 UTSW 4 129007763 missense probably damaging 1.00
R1878:Ak2 UTSW 4 129002167 missense probably damaging 1.00
R2002:Ak2 UTSW 4 129008229 missense probably benign 0.00
R2061:Ak2 UTSW 4 129008197 missense probably damaging 0.99
R4570:Ak2 UTSW 4 129002167 missense probably damaging 0.99
R5108:Ak2 UTSW 4 129002241 missense probably damaging 0.98
R5386:Ak2 UTSW 4 129008172 missense probably benign 0.41
R5667:Ak2 UTSW 4 129008247 missense probably damaging 1.00
R5671:Ak2 UTSW 4 129008247 missense probably damaging 1.00
R6190:Ak2 UTSW 4 128999183 missense probably damaging 1.00
R6936:Ak2 UTSW 4 128999212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTTGCTGACTATTGTGCTTC -3'
(R):5'- AGTGCTGCACATATGAGACAC -3'

Sequencing Primer
(F):5'- CTGATGTATTGTTCTCAGATCACTG -3'
(R):5'- GTGCTGCACATATGAGACACATCAAG -3'
Posted On2014-08-25