Incidental Mutation 'R2030:Nipbl'
ID 221177
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
MMRRC Submission 040037-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R2030 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8379771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1007 (V1007D)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: V1007D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: V1007D

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp C T 13: 41,981,735 (GRCm39) V13I probably damaging Het
Ak2 A G 4: 128,902,013 (GRCm39) K229E probably benign Het
Atp13a4 A T 16: 29,241,502 (GRCm39) V741D probably damaging Het
Bdp1 A T 13: 100,197,697 (GRCm39) M896K probably benign Het
Ccser1 C T 6: 61,288,547 (GRCm39) R237C probably benign Het
Cdk7 A G 13: 100,859,182 (GRCm39) probably benign Het
CK137956 A G 4: 127,845,180 (GRCm39) S188P probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dbndd2 A G 2: 164,330,563 (GRCm39) D72G probably damaging Het
Disp3 A T 4: 148,344,423 (GRCm39) I493N probably damaging Het
Dnaaf10 A T 11: 17,179,832 (GRCm39) T278S probably benign Het
Epx T C 11: 87,755,650 (GRCm39) D678G probably damaging Het
Fbxw5 G T 2: 25,394,810 (GRCm39) V235L probably damaging Het
Fmo4 T A 1: 162,621,741 (GRCm39) D490V probably damaging Het
Fuca2 A G 10: 13,382,518 (GRCm39) Y268C probably damaging Het
Gm4787 C T 12: 81,425,544 (GRCm39) V205I probably damaging Het
Gpat3 G A 5: 101,045,687 (GRCm39) R437K probably benign Het
Herc2 A G 7: 55,834,121 (GRCm39) S3109G probably damaging Het
Hr G A 14: 70,808,888 (GRCm39) R1117H probably damaging Het
Htra4 T A 8: 25,523,593 (GRCm39) D324V probably damaging Het
Kcnd3 A G 3: 105,366,853 (GRCm39) Y241C probably damaging Het
Kcp G A 6: 29,489,071 (GRCm39) L1072F probably damaging Het
Lrrc52 T C 1: 167,294,028 (GRCm39) N86D probably benign Het
Mindy4 A G 6: 55,188,247 (GRCm39) T26A probably damaging Het
Mre11a A T 9: 14,707,101 (GRCm39) N117Y probably damaging Het
Mrgprb1 A T 7: 48,097,076 (GRCm39) S279T possibly damaging Het
Myh13 T G 11: 67,241,064 (GRCm39) S814A probably benign Het
Ncapd2 A G 6: 125,153,678 (GRCm39) V679A possibly damaging Het
Nlrp12 T A 7: 3,277,049 (GRCm39) H960L probably damaging Het
Or3a1c T A 11: 74,046,769 (GRCm39) M263K possibly damaging Het
Or4a72 C T 2: 89,405,558 (GRCm39) V171I probably benign Het
Or7e169 A G 9: 19,757,709 (GRCm39) S69P probably benign Het
Pklr A G 3: 89,050,545 (GRCm39) Y402C probably damaging Het
Prdm2 T C 4: 142,859,334 (GRCm39) T1319A possibly damaging Het
Rif1 T A 2: 51,982,358 (GRCm39) V541E probably damaging Het
Ryk T A 9: 102,758,855 (GRCm39) I248N possibly damaging Het
Shisa2 A T 14: 59,867,134 (GRCm39) I129F probably damaging Het
Snap25 T G 2: 136,611,973 (GRCm39) probably benign Het
Snx31 G A 15: 36,525,848 (GRCm39) P284S probably benign Het
Spata31g1 C T 4: 42,974,131 (GRCm39) Q1155* probably null Het
Tas2r140 A G 6: 40,469,154 (GRCm39) K328R possibly damaging Het
Tas2r140 T C 6: 133,032,213 (GRCm39) T182A probably benign Het
Thumpd2 G A 17: 81,372,387 (GRCm39) R35C probably damaging Het
Tnxb A T 17: 34,937,443 (GRCm39) N3811Y probably damaging Het
Tpte A C 8: 22,835,901 (GRCm39) N428T probably damaging Het
Trpm6 A G 19: 18,831,629 (GRCm39) D1498G probably benign Het
Tsc2 C T 17: 24,842,444 (GRCm39) probably benign Het
Ttn C T 2: 76,703,277 (GRCm39) probably benign Het
Wdr24 A G 17: 26,045,017 (GRCm39) I251V probably benign Het
Zc3h6 T C 2: 128,848,006 (GRCm39) Y278H probably damaging Het
Zfat A G 15: 67,990,783 (GRCm39) probably null Het
Zfp442 A T 2: 150,250,042 (GRCm39) V620E possibly damaging Het
Zfp788 A G 7: 41,298,984 (GRCm39) H540R probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,356,616 (GRCm39) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5644:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,354,133 (GRCm39) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,366,373 (GRCm39) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGACTCATTCAAGTATAGGTGAG -3'
(R):5'- CGAATTTCCAAGCTATTTGTTGGG -3'

Sequencing Primer
(F):5'- TCACTGTTGTTTTATTTAACTGTTGC -3'
(R):5'- GTCTGGTGCATTGAAAAATTTCGTC -3'
Posted On 2014-08-25