Mutagenetix > Incidental Mutation

Incidental Mutation 'R2031:Mrc1'

221203

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

040038-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R2031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14326584 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1161 (T1161S)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028045
AA Change: T1161S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: T1161S

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.2114

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1b	G	T	5: 121,639,118 (GRCm39)	N642K	possibly damaging	Het
Akap11	T	A	14: 78,747,477 (GRCm39)	I1637L	possibly damaging	Het
Aoc1l1	T	C	6: 48,952,789 (GRCm39)	V238A	probably damaging	Het
Arhgap28	G	T	17: 68,203,111 (GRCm39)	T114N	probably damaging	Het
Arid5b	A	G	10: 68,114,518 (GRCm39)		probably null	Het
Atp10a	T	A	7: 58,477,678 (GRCm39)	C1292*	probably null	Het
Casp4	A	G	9: 5,321,401 (GRCm39)	S51G	probably benign	Het
Cast	T	C	13: 74,946,771 (GRCm39)		probably null	Het
Ccdc87	T	C	19: 4,891,715 (GRCm39)	F736L	probably damaging	Het
Cdon	T	C	9: 35,415,370 (GRCm39)	S1203P	probably damaging	Het
Cep290	G	A	10: 100,348,262 (GRCm39)		probably null	Het
Cep85	A	G	4: 133,859,761 (GRCm39)	V634A	probably benign	Het
Cpeb3	C	T	19: 37,022,079 (GRCm39)	R589H	probably damaging	Het
Crebrf	T	G	17: 26,961,895 (GRCm39)	S331A	probably damaging	Het
Cul5	A	G	9: 53,578,480 (GRCm39)	V36A	probably benign	Het
Dock2	T	A	11: 34,618,297 (GRCm39)		probably benign	Het
Dstyk	G	A	1: 132,380,929 (GRCm39)	A475T	probably damaging	Het
Enpp6	C	A	8: 47,506,649 (GRCm39)	P151Q	probably damaging	Het
Fan1	A	G	7: 64,004,172 (GRCm39)	Y765H	probably damaging	Het
Hsfy2	A	T	1: 56,675,476 (GRCm39)	S354T	probably benign	Het
Ifi204	A	C	1: 173,580,343 (GRCm39)	F389C	probably damaging	Het
Ikbip	T	C	10: 90,932,474 (GRCm39)	Y373H	probably benign	Het
Kbtbd11	C	A	8: 15,078,021 (GRCm39)	P207T	possibly damaging	Het
Krt73	A	C	15: 101,707,199 (GRCm39)		probably benign	Het
Mfsd6	T	A	1: 52,748,013 (GRCm39)	Q284L	probably benign	Het
Mmp1b	T	A	9: 7,368,607 (GRCm39)	D415V	possibly damaging	Het
Ms4a18	A	G	19: 10,991,014 (GRCm39)	S27P	probably benign	Het
Muc6	G	A	7: 141,218,313 (GRCm39)	S2120F	possibly damaging	Het
Mycbp2	G	T	14: 103,426,028 (GRCm39)	R2366S	probably damaging	Het
Nfkbia	A	G	12: 55,537,937 (GRCm39)	L172P	probably damaging	Het
Nrros	C	T	16: 31,962,975 (GRCm39)	W311*	probably null	Het
Or1d2	A	G	11: 74,255,777 (GRCm39)	Y94C	probably damaging	Het
Or2ag15	A	G	7: 106,341,105 (GRCm39)	F12S	probably damaging	Het
Or4c107	A	G	2: 88,789,643 (GRCm39)	T278A	probably benign	Het
Or51f1e	A	G	7: 102,747,371 (GRCm39)	Y141C	probably damaging	Het
Or5an10	A	T	19: 12,275,740 (GRCm39)	V252D	probably damaging	Het
Or5b112	T	C	19: 13,319,770 (GRCm39)	L216S	probably benign	Het
Parvb	A	T	15: 84,167,036 (GRCm39)	Y117F	probably benign	Het
Plch2	A	G	4: 155,127,484 (GRCm39)		probably benign	Het
Plxnb2	A	T	15: 89,047,013 (GRCm39)	C769*	probably null	Het
Plxnc1	G	T	10: 94,779,529 (GRCm39)	D304E	probably benign	Het
Prkg2	T	C	5: 99,172,310 (GRCm39)	D135G	possibly damaging	Het
Ptprb	A	G	10: 116,153,448 (GRCm39)	D635G	probably benign	Het
Rapgef6	T	G	11: 54,443,684 (GRCm39)	V89G	probably benign	Het
Ror2	T	A	13: 53,271,366 (GRCm39)	T330S	probably benign	Het
Ros1	A	G	10: 51,943,164 (GRCm39)	V2050A	possibly damaging	Het
Serpinb6e	T	C	13: 34,021,733 (GRCm39)		probably benign	Het
Skp2	C	A	15: 9,113,786 (GRCm39)	G376C	probably damaging	Het
Smarca4	T	C	9: 21,597,358 (GRCm39)	V1371A	possibly damaging	Het
Syvn1	G	A	19: 6,100,560 (GRCm39)	R317H	probably damaging	Het
Tdo2	T	A	3: 81,876,812 (GRCm39)	D139V	probably damaging	Het
Tmem130	A	G	5: 144,689,236 (GRCm39)	V135A	possibly damaging	Het
Tpr	A	T	1: 150,317,870 (GRCm39)	Q2126L	probably benign	Het
Txlnb	A	G	10: 17,706,062 (GRCm39)	M324V	possibly damaging	Het
Ubxn10	A	G	4: 138,448,574 (GRCm39)	M34T	possibly damaging	Het
Vmn2r95	T	C	17: 18,659,717 (GRCm39)	W154R	possibly damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGTAAACCTAAAGATGGTCATGA -3'
(R):5'- TGGAGATTCCCCAACCTCC -3'

Sequencing Primer
(F):5'- AAGAAAGAGTGCTTTTACTGAATTTG -3'
(R):5'- GGAGATTCCCCAACCTCCTTTTG -3'

Posted On

2014-08-25