Incidental Mutation 'R1973:Iqgap3'
ID221208
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 88083928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000195465]
Predicted Effect probably null
Transcript: ENSMUST00000071812
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193940
Predicted Effect probably benign
Transcript: ENSMUST00000195465
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.6316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnfaip3 T C 10: 19,004,504 N605S probably damaging Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTTCAGAGCTGAGGTCCCTG -3'
(R):5'- AACTTGCCCTTTCCAGCAGC -3'

Sequencing Primer
(F):5'- AGACAGGGTTTCACTGTATAGCCC -3'
(R):5'- AGCACAGCCCCTTGTCTG -3'
Posted On2014-08-25