Incidental Mutation 'R2031:Doxl2'
ID221225
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R2031 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48975855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 238 (V238A)
Ref Sequence ENSEMBL: ENSMUSP00000087517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect probably damaging
Transcript: ENSMUST00000090063
AA Change: V238A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: V238A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184917
AA Change: V238A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: V238A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Ros1 A G 10: 52,067,068 V2050A possibly damaging Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1443:Doxl2 UTSW 6 48975915 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R4823:Doxl2 UTSW 6 48975261 missense probably damaging 1.00
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5520:Doxl2 UTSW 6 48975794 missense possibly damaging 0.93
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6024:Doxl2 UTSW 6 48976096 missense possibly damaging 0.71
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6268:Doxl2 UTSW 6 48977682 missense probably benign 0.01
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
R7131:Doxl2 UTSW 6 48976372 nonsense probably null
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCAATGGCCAGTGTCTGAC -3'
(R):5'- AGATCACAGTGTTACCCTCTAGG -3'

Sequencing Primer
(F):5'- AATGGCCAGTGTCTGACCTTCAC -3'
(R):5'- ACATGGGGCCCAGATTTTC -3'
Posted On2014-08-25