Incidental Mutation 'R2031:Ros1'
ID221252
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 040038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2031 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52067068 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2050 (V2050A)
Ref Sequence ENSEMBL: ENSMUSP00000020045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020045
AA Change: V2050A

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: V2050A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117992
AA Change: V2029A

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: V2029A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218452
AA Change: V2029A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219173
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,055 N642K possibly damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Arhgap28 G T 17: 67,896,116 T114N probably damaging Het
Arid5b A G 10: 68,278,688 probably null Het
Atp10a T A 7: 58,827,930 C1292* probably null Het
Casp4 A G 9: 5,321,401 S51G probably benign Het
Cast T C 13: 74,798,652 probably null Het
Ccdc87 T C 19: 4,841,687 F736L probably damaging Het
Cdon T C 9: 35,504,074 S1203P probably damaging Het
Cep290 G A 10: 100,512,400 probably null Het
Cep85 A G 4: 134,132,450 V634A probably benign Het
Cpeb3 C T 19: 37,044,679 R589H probably damaging Het
Crebrf T G 17: 26,742,921 S331A probably damaging Het
Cul5 A G 9: 53,667,180 V36A probably benign Het
Dock2 T A 11: 34,727,470 probably benign Het
Doxl2 T C 6: 48,975,855 V238A probably damaging Het
Dstyk G A 1: 132,453,191 A475T probably damaging Het
Enpp6 C A 8: 47,053,614 P151Q probably damaging Het
Fan1 A G 7: 64,354,424 Y765H probably damaging Het
Hsfy2 A T 1: 56,636,317 S354T probably benign Het
Ifi204 A C 1: 173,752,777 F389C probably damaging Het
Ikbip T C 10: 91,096,612 Y373H probably benign Het
Kbtbd11 C A 8: 15,028,021 P207T possibly damaging Het
Krt73 A C 15: 101,798,764 probably benign Het
Mfsd6 T A 1: 52,708,854 Q284L probably benign Het
Mmp1b T A 9: 7,368,607 D415V possibly damaging Het
Mrc1 A T 2: 14,321,773 T1161S probably damaging Het
Ms4a18 A G 19: 11,013,650 S27P probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Mycbp2 G T 14: 103,188,592 R2366S probably damaging Het
Nfkbia A G 12: 55,491,152 L172P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr1212 A G 2: 88,959,299 T278A probably benign Het
Olfr1436 A T 19: 12,298,376 V252D probably damaging Het
Olfr1466 T C 19: 13,342,406 L216S probably benign Het
Olfr412 A G 11: 74,364,951 Y94C probably damaging Het
Olfr585 A G 7: 103,098,164 Y141C probably damaging Het
Olfr697 A G 7: 106,741,898 F12S probably damaging Het
Parvb A T 15: 84,282,835 Y117F probably benign Het
Plch2 A G 4: 155,043,027 probably benign Het
Plxnb2 A T 15: 89,162,810 C769* probably null Het
Plxnc1 G T 10: 94,943,667 D304E probably benign Het
Prkg2 T C 5: 99,024,451 D135G possibly damaging Het
Ptprb A G 10: 116,317,543 D635G probably benign Het
Rapgef6 T G 11: 54,552,858 V89G probably benign Het
Ror2 T A 13: 53,117,330 T330S probably benign Het
Serpinb6e T C 13: 33,837,750 probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Smarca4 T C 9: 21,686,062 V1371A possibly damaging Het
Syvn1 G A 19: 6,050,530 R317H probably damaging Het
Tdo2 T A 3: 81,969,505 D139V probably damaging Het
Tmem130 A G 5: 144,752,426 V135A possibly damaging Het
Tpr A T 1: 150,442,119 Q2126L probably benign Het
Txlnb A G 10: 17,830,314 M324V possibly damaging Het
Ubxn10 A G 4: 138,721,263 M34T possibly damaging Het
Vmn2r95 T C 17: 18,439,455 W154R possibly damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACTCTCTACTATAATACTGCTGC -3'
(R):5'- ATAGCTTGCTGCCAGGTATG -3'

Sequencing Primer
(F):5'- ATACTGCTGCTTTGTAATGAATGTG -3'
(R):5'- CTTGCTGCCAGGTATGTTTGTATG -3'
Posted On2014-08-25