Incidental Mutation 'R1973:Tnfaip3'
ID221272
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission 039986-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1973 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19004504 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 605 (N605S)
Ref Sequence ENSEMBL: ENSMUSP00000101167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863]
Predicted Effect probably damaging
Transcript: ENSMUST00000019997
AA Change: N605S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: N605S

DomainStartEndE-ValueType
Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105527
AA Change: N605S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: N605S

DomainStartEndE-ValueType
Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122863
SMART Domains Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:2VFJ|D 1 122 2e-83 PDB
SCOP:d1e3ha3 18 109 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154749
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A C 5: 8,812,746 I143L probably benign Het
Acp7 T A 7: 28,607,989 D481V probably damaging Het
AI597479 T A 1: 43,111,126 I132K probably benign Het
Anxa13 T C 15: 58,356,181 noncoding transcript Het
Brca1 A T 11: 101,526,403 C302S probably benign Het
Brd8 T A 18: 34,608,013 D420V probably damaging Het
Cacna1g A T 11: 94,459,777 V414E possibly damaging Het
Ccdc142 T A 6: 83,102,563 C294S probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chd6 A G 2: 160,966,387 S1636P probably damaging Het
Clec4a1 A G 6: 122,924,834 probably null Het
Col6a3 A T 1: 90,804,175 I1452N probably damaging Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Dscr3 T C 16: 94,501,546 N267S probably damaging Het
Efl1 T C 7: 82,762,877 S825P probably damaging Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Faxc G A 4: 21,993,405 E350K probably benign Het
Frem2 T A 3: 53,652,232 Y1618F probably benign Het
Fubp3 A G 2: 31,603,286 T6A probably benign Het
Gm5814 A T 17: 47,410,549 M63L probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Kcnh3 T C 15: 99,229,400 V359A probably damaging Het
Kit G A 5: 75,615,442 A295T probably damaging Het
Krt77 G T 15: 101,861,244 A397E probably damaging Het
Mis18bp1 G C 12: 65,149,076 S638* probably null Het
Neurl4 C T 11: 69,909,292 P1091S probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nos1 A G 5: 117,936,426 T1046A possibly damaging Het
Nsfl1c G T 2: 151,505,414 S202I probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Nwd1 T C 8: 72,704,962 V1195A possibly damaging Het
Olfr243 T A 7: 103,716,597 M1K probably null Het
Olfr370 T C 8: 83,541,792 V216A probably benign Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Olfr919 A G 9: 38,697,868 V170A probably damaging Het
Pclo G T 5: 14,676,059 probably null Het
Pnpla7 A G 2: 25,016,617 D664G probably damaging Het
Prl8a1 G A 13: 27,576,934 T105I probably benign Het
Ptger1 C A 8: 83,669,454 T380K probably benign Het
Ptk7 G A 17: 46,586,807 Q282* probably null Het
Ptpn18 G T 1: 34,463,109 D45Y probably damaging Het
Rab11fip3 T C 17: 26,024,391 D589G probably damaging Het
Rara A G 11: 98,971,670 N299S possibly damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Rslcan18 T C 13: 67,108,023 probably benign Het
Rtel1 A G 2: 181,351,626 Y731C probably benign Het
Sec16a A T 2: 26,426,489 S1666R probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc10a7 T A 8: 78,697,333 probably null Het
Slc22a7 A G 17: 46,437,090 V214A probably damaging Het
Slc26a8 T C 17: 28,663,605 I249V probably benign Het
Slc38a4 T C 15: 96,999,597 K446E probably benign Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spef2 T G 15: 9,663,066 *876C probably null Het
Spink11 A G 18: 44,196,138 C14R unknown Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Trpc1 A G 9: 95,723,255 M283T probably benign Het
Ttn A G 2: 76,714,362 S32799P probably damaging Het
Ttn A G 2: 76,720,099 I31613T probably damaging Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Usp32 G T 11: 85,103,931 L52I probably benign Het
Usp33 A G 3: 152,360,286 T68A possibly damaging Het
Vmn1r7 A G 6: 57,025,026 F83S probably benign Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr43 A G 17: 71,640,240 N364D probably benign Het
Zdbf2 C A 1: 63,309,701 P2413Q unknown Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0744:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R3607:Tnfaip3 UTSW 10 19005602 missense probably damaging 1.00
R4386:Tnfaip3 UTSW 10 19007010 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6559:Tnfaip3 UTSW 10 19007248 missense probably damaging 1.00
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAGCCCATGGTAACTAGAGC -3'
(R):5'- TCACCAACGCTCCAAGTCTG -3'

Sequencing Primer
(F):5'- CATGGTAACTAGAGCTGCTGTCTAC -3'
(R):5'- CGCTCCAAGTCTGACCCC -3'
Posted On2014-08-25