Incidental Mutation 'R0138:Ciita'
ID22132
Institutional Source Beutler Lab
Gene Symbol Ciita
Ensembl Gene ENSMUSG00000022504
Gene Nameclass II transactivator
SynonymsC2ta, Gm9475
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location10480059-10528418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10512270 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 803 (D803V)
Ref Sequence ENSEMBL: ENSMUSP00000154946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023147
AA Change: D806V

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504
AA Change: D806V

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184863
SMART Domains Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

DomainStartEndE-ValueType
Pfam:Dexa_ind 1 95 4.6e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229906
Predicted Effect probably damaging
Transcript: ENSMUST00000230146
AA Change: D803V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230395
AA Change: D883V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000230450
AA Change: D782V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230533
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Ciita
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
deshabille UTSW 16 10509207 intron probably null
sisal UTSW 16 10513288 critical splice donor site probably null
R0001:Ciita UTSW 16 10514433 splice site probably benign
R0583:Ciita UTSW 16 10523804 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R5821:Ciita UTSW 16 10511805 missense possibly damaging 0.77
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
R6916:Ciita UTSW 16 10509207 intron probably null
R6937:Ciita UTSW 16 10512491 intron probably null
R7007:Ciita UTSW 16 10511307 missense probably damaging 1.00
R7219:Ciita UTSW 16 10512257 missense probably benign 0.00
R7326:Ciita UTSW 16 10512288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTCCGAGGAAGAAGAGACCC -3'
(R):5'- CAGGCTAGGCTGCGATTCTAGATG -3'

Sequencing Primer
(F):5'- GTACCTGAAGCGCCTGAAG -3'
(R):5'- gaatgacactctcccccac -3'
Posted On2013-04-12