Incidental Mutation 'R1974:Gsn'
ID221350
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Namegelsolin
Synonyms
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35256380-35307892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35301471 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 455 (G455V)
Ref Sequence ENSEMBL: ENSMUSP00000144296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000201185] [ENSMUST00000202990]
Predicted Effect probably damaging
Transcript: ENSMUST00000028239
AA Change: G493V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: G493V

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201185
AA Change: G444V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: G444V

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202990
AA Change: G455V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: G455V

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35284037 missense probably damaging 1.00
IGL02119:Gsn APN 2 35302495 missense probably damaging 1.00
IGL02512:Gsn APN 2 35283950 nonsense probably null
IGL02550:Gsn APN 2 35282607 intron probably benign
IGL02975:Gsn APN 2 35304654 missense probably benign 0.25
IGL03061:Gsn APN 2 35282459 intron probably benign
R0321:Gsn UTSW 2 35290396 missense probably benign 0.03
R0454:Gsn UTSW 2 35304639 missense probably damaging 1.00
R1446:Gsn UTSW 2 35306586 missense probably benign 0.04
R1760:Gsn UTSW 2 35284823 missense probably damaging 1.00
R2258:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2260:Gsn UTSW 2 35290337 missense probably damaging 1.00
R2281:Gsn UTSW 2 35283918 missense probably benign 0.01
R2495:Gsn UTSW 2 35303193 missense probably damaging 1.00
R2516:Gsn UTSW 2 35283953 missense probably benign
R3896:Gsn UTSW 2 35302638 missense possibly damaging 0.92
R4003:Gsn UTSW 2 35283983 missense probably benign 0.38
R4006:Gsn UTSW 2 35307621 nonsense probably null
R4281:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4291:Gsn UTSW 2 35290420 missense probably benign 0.14
R4692:Gsn UTSW 2 35298871 missense probably damaging 1.00
R4850:Gsn UTSW 2 35283900 splice site probably null
R4895:Gsn UTSW 2 35302578 missense probably damaging 1.00
R5011:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5013:Gsn UTSW 2 35298921 missense probably damaging 1.00
R5290:Gsn UTSW 2 35296472 missense probably benign 0.01
R6472:Gsn UTSW 2 35290451 unclassified probably null
R6764:Gsn UTSW 2 35284044 missense probably damaging 1.00
R7018:Gsn UTSW 2 35293506 missense probably benign 0.03
R7036:Gsn UTSW 2 35292599 missense probably damaging 1.00
R7097:Gsn UTSW 2 35295049 nonsense probably null
R7122:Gsn UTSW 2 35295049 nonsense probably null
R7183:Gsn UTSW 2 35294948 missense probably benign 0.00
R7203:Gsn UTSW 2 35298795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCACATTTAGGACAGGG -3'
(R):5'- TGACGGATGAACGGATGGAT -3'

Sequencing Primer
(F):5'- GCACATTTAGGACAGGGAATCTTC -3'
(R):5'- CGGATGGATAATTAGGCAGCTAAGTG -3'
Posted On2014-08-25