Incidental Mutation 'R1974:Hpse'
ID221386
Institutional Source Beutler Lab
Gene Symbol Hpse
Ensembl Gene ENSMUSG00000035273
Gene Nameheparanase
SynonymsHpa
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100679484-100719716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100692238 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 338 (S338P)
Ref Sequence ENSEMBL: ENSMUSP00000044072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]
Predicted Effect probably damaging
Transcript: ENSMUST00000045617
AA Change: S338P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: S338P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 132 362 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112908
AA Change: S338P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: S338P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 144 362 1.2e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Hpse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Hpse APN 5 100691330 missense possibly damaging 0.89
IGL00743:Hpse APN 5 100698999 missense probably benign 0.01
IGL02377:Hpse APN 5 100691333 missense probably damaging 1.00
R0082:Hpse UTSW 5 100692262 missense possibly damaging 0.93
R0194:Hpse UTSW 5 100719512 missense probably benign
R2065:Hpse UTSW 5 100698931 missense probably damaging 1.00
R2152:Hpse UTSW 5 100691403 nonsense probably null
R2405:Hpse UTSW 5 100708771 missense possibly damaging 0.78
R3791:Hpse UTSW 5 100692238 missense probably damaging 1.00
R5127:Hpse UTSW 5 100719537 missense unknown
R5147:Hpse UTSW 5 100719509 missense probably benign 0.00
R5385:Hpse UTSW 5 100708724 nonsense probably null
R6446:Hpse UTSW 5 100695569 nonsense probably null
R7009:Hpse UTSW 5 100692279 missense probably benign 0.01
X0022:Hpse UTSW 5 100691378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACAGTTTTAGGGCTCTC -3'
(R):5'- ATGGCCTATCAGTGGAGTTAAC -3'

Sequencing Primer
(F):5'- CCCTCGGAGACTGTACTTGATG -3'
(R):5'- TCCTTCTAGTAGGCCCATAAAAGAG -3'
Posted On2014-08-25