Incidental Mutation 'R1974:Atp5j2'
ID221397
Institutional Source Beutler Lab
Gene Symbol Atp5j2
Ensembl Gene ENSMUSG00000038690
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2
Synonyms1110019H14Rik, hypothetical protein, clone:2-31
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R1974 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145183698-145192062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145184579 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 64 (L64Q)
Ref Sequence ENSEMBL: ENSMUSP00000125504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037056] [ENSMUST00000070487] [ENSMUST00000160422] [ENSMUST00000160574] [ENSMUST00000160629] [ENSMUST00000161741] [ENSMUST00000162244] [ENSMUST00000162360]
Predicted Effect probably damaging
Transcript: ENSMUST00000037056
AA Change: L52Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039726
Gene: ENSMUSG00000038690
AA Change: L52Q

DomainStartEndE-ValueType
Pfam:WRW 1 73 1.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070487
SMART Domains Protein: ENSMUSP00000069243
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 35 61 1.7e-5 SMART
ZnF_C3H1 62 88 1.4e-10 SMART
ZnF_C3H1 90 110 3.7e-1 SMART
ZnF_C3H1 111 136 3.4e-9 SMART
low complexity region 143 157 N/A INTRINSIC
ZnF_C2HC 186 202 4.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160422
SMART Domains Protein: ENSMUSP00000125019
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 191 N/A INTRINSIC
ZnF_C2HC 244 260 1.04e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160437
Predicted Effect probably benign
Transcript: ENSMUST00000160574
Predicted Effect probably benign
Transcript: ENSMUST00000160629
SMART Domains Protein: ENSMUSP00000124899
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 189 N/A INTRINSIC
ZnF_C2HC 218 234 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160762
SMART Domains Protein: ENSMUSP00000125640
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 3 29 4.17e-3 SMART
ZnF_C3H1 30 56 3.41e-8 SMART
ZnF_C3H1 58 84 6.42e-4 SMART
ZnF_C3H1 86 110 2.86e-1 SMART
ZnF_C3H1 111 136 8.27e-7 SMART
low complexity region 143 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161741
AA Change: L64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125504
Gene: ENSMUSG00000038690
AA Change: L64Q

DomainStartEndE-ValueType
Pfam:WRW 6 84 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161845
Predicted Effect probably benign
Transcript: ENSMUST00000162244
SMART Domains Protein: ENSMUSP00000124966
Gene: ENSMUSG00000029625

DomainStartEndE-ValueType
ZnF_C3H1 35 61 4.17e-3 SMART
ZnF_C3H1 62 88 3.41e-8 SMART
ZnF_C3H1 90 116 6.42e-4 SMART
ZnF_C3H1 118 142 2.86e-1 SMART
ZnF_C3H1 143 168 8.27e-7 SMART
low complexity region 175 195 N/A INTRINSIC
ZnF_C2HC 219 235 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200584
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mfrp T C 9: 44,106,372 C554R probably damaging Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Atp5j2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Atp5j2 APN 5 145184568 missense probably benign 0.05
IGL02190:Atp5j2 APN 5 145183832 utr 3 prime probably benign
IGL02572:Atp5j2 APN 5 145187237 splice site probably benign
R0130:Atp5j2 UTSW 5 145188182 splice site probably benign
R4791:Atp5j2 UTSW 5 145184555 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTCCTCTCAGGTGGAAGAACG -3'
(R):5'- TGAATGGGCTTCAGATCCG -3'

Sequencing Primer
(F):5'- ACGCACAGGTCAGGAGCAC -3'
(R):5'- CTTGGGTTATGGAGATAGAACATCAC -3'
Posted On2014-08-25