Incidental Mutation 'R0138:Cebpz'
ID22141
Institutional Source Beutler Lab
Gene Symbol Cebpz
Ensembl Gene ENSMUSG00000024081
Gene NameCCAAT/enhancer binding protein zeta
SynonymsCebpa-rs1, Cbf, CBF2
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0138 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location78919006-78937070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78931391 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 663 (S663P)
Ref Sequence ENSEMBL: ENSMUSP00000024885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024885]
Predicted Effect probably benign
Transcript: ENSMUST00000024885
AA Change: S663P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024885
Gene: ENSMUSG00000024081
AA Change: S663P

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
coiled coil region 113 143 N/A INTRINSIC
Pfam:CBF 523 732 5.7e-58 PFAM
low complexity region 834 851 N/A INTRINSIC
low complexity region 881 904 N/A INTRINSIC
low complexity region 957 969 N/A INTRINSIC
low complexity region 1028 1042 N/A INTRINSIC
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the CEBP family. The encoded protein plays a role in cellular response to environmental stimuli through a transcriptional process that involves heat shock factors, conserved DNA elements (heat shock elements or HSEs) and CCAAT boxes. The protein acts as a DNA-binding transcriptional activator and regulates the heat-shock protein 70 (HSP70) promoter in a CCAAT-dependent manner. The protein is also involved in cell growth and differentiation, particularly, hematopoietic differentiation. Methylation of the promoter of this gene or mutations within the gene may be correlated with occurance of acute myeloid leukemia (AML). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tcerg1 C T 18: 42,568,614 probably benign Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Cebpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Cebpz APN 17 78934830 missense probably damaging 1.00
IGL01558:Cebpz APN 17 78935305 missense probably damaging 1.00
IGL01724:Cebpz APN 17 78935913 missense probably benign 0.01
IGL01938:Cebpz APN 17 78934961 nonsense probably null
IGL02165:Cebpz APN 17 78922169 missense probably damaging 1.00
IGL02397:Cebpz APN 17 78923261 missense possibly damaging 0.63
IGL02455:Cebpz APN 17 78935036 missense probably benign 0.16
IGL02690:Cebpz APN 17 78922557 missense probably damaging 1.00
IGL02698:Cebpz APN 17 78935574 missense probably benign 0.03
IGL02755:Cebpz APN 17 78931330 missense probably damaging 1.00
IGL02827:Cebpz APN 17 78929331 missense probably damaging 1.00
IGL03149:Cebpz APN 17 78922553 missense probably benign 0.01
cedar_hill UTSW 17 78936910 missense possibly damaging 0.87
R0125:Cebpz UTSW 17 78919888 missense possibly damaging 0.95
R0310:Cebpz UTSW 17 78926124 missense probably damaging 1.00
R0436:Cebpz UTSW 17 78935650 missense probably benign 0.00
R0589:Cebpz UTSW 17 78936879 missense probably damaging 1.00
R0828:Cebpz UTSW 17 78925982 missense probably benign 0.04
R1355:Cebpz UTSW 17 78935324 missense probably benign 0.01
R1367:Cebpz UTSW 17 78923313 missense probably benign
R1583:Cebpz UTSW 17 78934752 missense probably damaging 1.00
R1639:Cebpz UTSW 17 78934606 missense possibly damaging 0.49
R1818:Cebpz UTSW 17 78935376 missense probably damaging 1.00
R1885:Cebpz UTSW 17 78932116 missense probably benign 0.00
R1908:Cebpz UTSW 17 78934907 nonsense probably null
R1909:Cebpz UTSW 17 78934907 nonsense probably null
R2094:Cebpz UTSW 17 78935554 missense probably benign 0.03
R2314:Cebpz UTSW 17 78920547 critical splice donor site probably null
R2763:Cebpz UTSW 17 78935929 missense probably benign
R2874:Cebpz UTSW 17 78932103 splice site probably benign
R3807:Cebpz UTSW 17 78935418 missense probably damaging 1.00
R4012:Cebpz UTSW 17 78924467 missense probably damaging 0.98
R5344:Cebpz UTSW 17 78926113 missense possibly damaging 0.82
R5394:Cebpz UTSW 17 78922205 missense probably benign 0.34
R5711:Cebpz UTSW 17 78934611 missense probably damaging 1.00
R5902:Cebpz UTSW 17 78925937 missense probably benign 0.20
R6238:Cebpz UTSW 17 78936910 missense possibly damaging 0.87
R6257:Cebpz UTSW 17 78935832 missense probably benign 0.17
R6825:Cebpz UTSW 17 78919963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCTCCAGAATTGTCACACG -3'
(R):5'- CAGTGAGTCTCTGAAACTCTGCACC -3'

Sequencing Primer
(F):5'- TTGTCACACGCATGTGCATG -3'
(R):5'- TCTGAAACTCTGCACCACATAAATG -3'
Posted On2013-04-12