Incidental Mutation 'R2032:Olfr1417'
ID221423
Institutional Source Beutler Lab
Gene Symbol Olfr1417
Ensembl Gene ENSMUSG00000048292
Gene Nameolfactory receptor 1417
SynonymsGA_x6K02T2RE5P-2172809-2171862, MOR266-2
MMRRC Submission 040039-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2032 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11826803-11839219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11828300 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 242 (C242Y)
Ref Sequence ENSEMBL: ENSMUSP00000149141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061235] [ENSMUST00000214887]
Predicted Effect probably damaging
Transcript: ENSMUST00000061235
AA Change: C242Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062542
Gene: ENSMUSG00000048292
AA Change: C242Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.3e-53 PFAM
Pfam:7tm_1 41 291 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213141
Predicted Effect probably damaging
Transcript: ENSMUST00000214887
AA Change: C242Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,243,052 G674E probably damaging Het
Abca3 G A 17: 24,366,082 probably benign Het
Abca7 C T 10: 80,008,237 T1359M probably damaging Het
Acox2 A G 14: 8,246,400 S464P probably benign Het
Adgrf1 C T 17: 43,311,275 T801I probably damaging Het
Akap11 T A 14: 78,510,037 I1637L possibly damaging Het
Akap12 C A 10: 4,356,673 A1161D possibly damaging Het
Ankrd36 T A 11: 5,628,616 V635D possibly damaging Het
Ankrd44 C T 1: 54,723,009 probably null Het
Atl2 A G 17: 79,895,944 V28A probably benign Het
Atxn3 A T 12: 101,942,194 L133* probably null Het
Bmp2 T C 2: 133,561,296 S256P probably benign Het
Ccdc138 T A 10: 58,513,162 Y177N possibly damaging Het
Cep164 C T 9: 45,771,600 V931M probably damaging Het
CK137956 T C 4: 127,945,276 T450A probably benign Het
Col23a1 G A 11: 51,560,008 G215D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd6a T C 14: 26,604,749 M5T probably benign Het
Dnajc6 T G 4: 101,614,238 I284S probably benign Het
Dolpp1 C T 2: 30,392,441 A2V probably damaging Het
Eml2 C T 7: 19,202,555 T711I probably benign Het
Evi5l T C 8: 4,210,622 D1065G probably damaging Het
Fam110b G T 4: 5,799,460 A293S probably benign Het
Fap A G 2: 62,542,237 V266A probably benign Het
Fgf10 A T 13: 118,715,595 Y71F probably damaging Het
Gm3443 G T 19: 21,555,800 G43C probably damaging Het
Gm4788 T A 1: 139,733,255 probably benign Het
Gm6583 G A 5: 112,355,112 T242I possibly damaging Het
Gm7257 T C 9: 36,432,899 probably null Het
Gm8251 C A 1: 44,061,740 C66F possibly damaging Het
Gpr146 T C 5: 139,379,147 probably benign Het
Hif3a A T 7: 17,051,179 L172H probably damaging Het
Mas1 T C 17: 12,842,570 probably benign Het
Nlrp5 G A 7: 23,421,512 R717Q probably damaging Het
Nop14 A G 5: 34,659,939 V36A possibly damaging Het
Olfr33 A T 7: 102,713,876 I179N probably benign Het
Olfr57 T A 10: 79,035,329 F178I possibly damaging Het
Parp4 T A 14: 56,629,096 I1039K possibly damaging Het
Pold2 A T 11: 5,876,757 I59N probably benign Het
Prr36 T C 8: 4,214,304 probably benign Het
Pyroxd2 T C 19: 42,727,649 probably benign Het
Recql C T 6: 142,367,283 G403R probably damaging Het
Serpina3m T A 12: 104,389,669 D198E probably benign Het
Sik2 A T 9: 50,995,647 Y93N probably damaging Het
Slc27a3 C T 3: 90,387,397 R389H probably damaging Het
Slc29a1 A T 17: 45,586,109 M417K probably damaging Het
Syt13 A G 2: 92,953,401 K339E probably damaging Het
Tmem237 A T 1: 59,109,106 H163Q probably benign Het
Tram2 C T 1: 21,003,956 G253R probably null Het
Trpv1 A G 11: 73,238,385 T43A probably benign Het
Ugt2b34 A G 5: 86,891,272 I510T probably damaging Het
Vmn1r224 C A 17: 20,419,396 D78E probably benign Het
Vmn1r78 A T 7: 12,153,283 I274L probably benign Het
Wdfy4 C T 14: 33,146,989 V361I probably benign Het
Zpbp2 A T 11: 98,554,708 K165N probably damaging Het
Other mutations in Olfr1417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0530:Olfr1417 UTSW 19 11828192 missense probably benign 0.26
R1532:Olfr1417 UTSW 19 11828619 missense probably benign 0.00
R1730:Olfr1417 UTSW 19 11828081 missense probably benign 0.06
R2237:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2238:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2239:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R4959:Olfr1417 UTSW 19 11828936 missense probably benign
R4973:Olfr1417 UTSW 19 11828936 missense probably benign
R5015:Olfr1417 UTSW 19 11828118 missense probably benign 0.00
R6799:Olfr1417 UTSW 19 11828814 missense possibly damaging 0.91
R6984:Olfr1417 UTSW 19 11828304 missense probably damaging 1.00
R7063:Olfr1417 UTSW 19 11828184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCCAGTGTCTGAGAGGATC -3'
(R):5'- TGAGACTGGCATGTGCAGAC -3'

Sequencing Primer
(F):5'- CATTGTTTTTCAAGCAGGAGGAAGC -3'
(R):5'- GCATGTGCAGACACCCATG -3'
Posted On2014-08-25