Mutagenetix > Incidental Mutation

Incidental Mutation 'R1974:Calr'

221424

Institutional Source

Beutler Lab

Gene Symbol

Calr

Ensembl Gene

ENSMUSG00000003814

Gene Name

calreticulin

Synonyms

Calregulin, CRT

MMRRC Submission

039987-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1974 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85568717-85573560 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85570786 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 290 (I290V)

Ref Sequence

ENSEMBL: ENSMUSP00000003912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000003912] [ENSMUST00000109761] [ENSMUST00000128035]

AlphaFold

P14211

PDB Structure

Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000003911

SMART Domains

Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	229	272	5.7e-8	SMART
low complexity region	296	307	N/A	INTRINSIC
UBA	319	356	9.11e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000003912
AA Change: I290V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: I290V

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Calreticulin	23	258	2.7e-64	PFAM
Pfam:Calreticulin	257	332	3.3e-24	PFAM
low complexity region	358	407	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109761

SMART Domains

Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART
low complexity region	297	308	N/A	INTRINSIC
UBA	320	357	9.11e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128028

Predicted Effect

probably benign
Transcript: ENSMUST00000128035

SMART Domains

Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

Domain	Start	End	E-Value	Type
UBQ	3	77	3.28e-23	SMART
low complexity region	123	151	N/A	INTRINSIC
UBA	163	200	8.76e-11	SMART
STI1	230	273	5.7e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154774

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141347

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 137,773,028 (GRCm39)	L739Q	probably damaging	Het
4933436I01Rik	A	T	X: 66,963,655 (GRCm39)	Y401*	probably null	Het
Abcg3	A	G	5: 105,111,504 (GRCm39)	V321A	probably benign	Het
Acad10	C	A	5: 121,764,248 (GRCm39)	V894L	possibly damaging	Het
Adam9	A	G	8: 25,482,240 (GRCm39)	I255T	probably damaging	Het
Ago3	T	C	4: 126,240,544 (GRCm39)	Y785C	probably damaging	Het
Aif1	G	A	17: 35,391,127 (GRCm39)	P44L	probably benign	Het
Akap4	A	G	X: 6,943,595 (GRCm39)	S633G	probably benign	Het
Alox15	T	A	11: 70,240,799 (GRCm39)	T194S	probably benign	Het
Amh	T	C	10: 80,642,250 (GRCm39)	S207P	probably benign	Het
Apc	T	A	18: 34,433,057 (GRCm39)	C415S	possibly damaging	Het
Atg14	G	A	14: 47,783,298 (GRCm39)	R346C	probably damaging	Het
Atp5mf	A	T	5: 145,121,389 (GRCm39)	L64Q	probably damaging	Het
Barhl2	C	G	5: 106,605,179 (GRCm39)	E177Q	probably benign	Het
C1qtnf5	T	C	9: 44,020,072 (GRCm39)	V232A	probably damaging	Het
Cdh19	G	C	1: 110,817,889 (GRCm39)	Q618E	possibly damaging	Het
Celsr2	G	T	3: 108,321,530 (GRCm39)	D427E	probably damaging	Het
Cep250	T	C	2: 155,831,424 (GRCm39)	S1294P	probably damaging	Het
Chrna7	T	A	7: 62,749,034 (GRCm39)	T483S	probably damaging	Het
Clmn	A	T	12: 104,758,121 (GRCm39)	W132R	probably damaging	Het
Cpsf2	G	A	12: 101,956,306 (GRCm39)	D370N	probably benign	Het
Crnn	T	C	3: 93,056,594 (GRCm39)	V460A	probably benign	Het
Daam1	T	A	12: 72,035,703 (GRCm39)	I957N	probably damaging	Het
Defb9	T	C	8: 22,371,905 (GRCm39)	K36R	probably benign	Het
Dock10	T	A	1: 80,488,143 (GRCm39)	I2007F	possibly damaging	Het
Dpm1	A	T	2: 168,059,667 (GRCm39)	V143D	probably damaging	Het
Dync1h1	T	C	12: 110,592,166 (GRCm39)	V1110A	possibly damaging	Het
Erlec1	T	G	11: 30,889,604 (GRCm39)	K373N	possibly damaging	Het
Fbxo40	C	T	16: 36,790,303 (GRCm39)	G269E	probably benign	Het
Fbxw7	T	A	3: 84,862,242 (GRCm39)	C70S	possibly damaging	Het
Fhip2a	T	C	19: 57,373,809 (GRCm39)	F690L	probably damaging	Het
Fnbp1	G	T	2: 30,943,059 (GRCm39)	R280S	probably null	Het
Gapvd1	G	A	2: 34,590,853 (GRCm39)	R940C	probably damaging	Het
Gfod2	T	C	8: 106,444,142 (GRCm39)	K134E	possibly damaging	Het
Gpi1	A	T	7: 33,920,228 (GRCm39)		probably null	Het
Grik2	A	T	10: 49,008,923 (GRCm39)	N721K	possibly damaging	Het
Gsn	G	T	2: 35,191,483 (GRCm39)	G455V	probably damaging	Het
Hlx	G	T	1: 184,464,184 (GRCm39)	A52D	probably damaging	Het
Hpse	A	G	5: 100,840,104 (GRCm39)	S338P	probably damaging	Het
Hyal2	T	C	9: 107,449,371 (GRCm39)	C376R	probably damaging	Het
Inf2	A	G	12: 112,574,771 (GRCm39)	T781A	unknown	Het
Iscu	A	G	5: 113,915,079 (GRCm39)		probably benign	Het
Kcna4	G	A	2: 107,126,565 (GRCm39)	G433D	possibly damaging	Het
Kir3dl2	T	A	X: 135,357,024 (GRCm39)	N146I	probably benign	Het
Klrg1	T	A	6: 122,259,721 (GRCm39)	Q17L	possibly damaging	Het
Krt82	T	G	15: 101,453,597 (GRCm39)	Q263P	probably benign	Het
Mfrp	T	C	9: 44,017,669 (GRCm39)	C554R	probably damaging	Het
Minar1	T	G	9: 89,483,256 (GRCm39)	T714P	probably damaging	Het
Mst1r	T	C	9: 107,791,962 (GRCm39)	Y833H	probably damaging	Het
Mst1r	T	A	9: 107,793,132 (GRCm39)		probably null	Het
Nfix	G	A	8: 85,453,155 (GRCm39)	R300C	probably damaging	Het
Nipal4	T	C	11: 46,042,210 (GRCm39)	N157S	probably damaging	Het
Notch2	G	A	3: 97,980,071 (GRCm39)	G195D	probably damaging	Het
Nrcam	A	T	12: 44,610,776 (GRCm39)	H492L	probably benign	Het
Or10aa1	A	T	1: 173,870,154 (GRCm39)	I213F	probably damaging	Het
Or4p21	A	T	2: 88,276,853 (GRCm39)	I143N	probably damaging	Het
Papln	G	A	12: 83,828,811 (GRCm39)	R817H	probably damaging	Het
Pcnx2	T	C	8: 126,614,110 (GRCm39)	E447G	probably benign	Het
Pdp2	T	C	8: 105,320,538 (GRCm39)	V129A	probably benign	Het
Plch2	A	G	4: 155,069,410 (GRCm39)	F1072S	possibly damaging	Het
Prag1	T	A	8: 36,570,081 (GRCm39)	D221E	probably damaging	Het
Prkg1	T	C	19: 31,563,095 (GRCm39)	D102G	probably damaging	Het
Psme4	T	A	11: 30,769,011 (GRCm39)	D662E	probably benign	Het
Ptprn	T	C	1: 75,231,464 (GRCm39)		probably null	Het
Ptprz1	A	G	6: 22,986,310 (GRCm39)	D370G	probably damaging	Het
Qser1	A	G	2: 104,590,886 (GRCm39)	S1637P	probably damaging	Het
Sema6a	T	A	18: 47,403,696 (GRCm39)	H642L	probably benign	Het
Slc30a5	A	T	13: 100,950,461 (GRCm39)	F209I	probably benign	Het
Slc4a3	G	T	1: 75,528,835 (GRCm39)	E508*	probably null	Het
Stpg2	C	T	3: 139,014,944 (GRCm39)	R370*	probably null	Het
Tas2r113	T	A	6: 132,870,796 (GRCm39)	F275I	probably benign	Het
Tmem132d	T	G	5: 128,346,263 (GRCm39)	K86N	probably damaging	Het
Tpgs2	A	T	18: 25,273,593 (GRCm39)	F189L	probably damaging	Het
Trmt6	A	G	2: 132,652,968 (GRCm39)	S104P	probably damaging	Het
Trpv3	T	C	11: 73,174,514 (GRCm39)	S294P	probably damaging	Het
Ugt2b36	A	G	5: 87,228,727 (GRCm39)		probably null	Het
Vmn1r170	A	T	7: 23,305,906 (GRCm39)	M103L	probably benign	Het
Vmn2r107	T	A	17: 20,575,879 (GRCm39)		probably null	Het
Vmn2r5	C	T	3: 64,411,642 (GRCm39)	E309K	probably damaging	Het
Vmn2r77	T	C	7: 86,449,964 (GRCm39)	V70A	probably benign	Het

Other mutations in Calr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Calr	APN	8	85,571,373 (GRCm39)	missense	possibly damaging	0.89
IGL00648:Calr	APN	8	85,569,331 (GRCm39)	unclassified	probably benign
IGL01309:Calr	APN	8	85,573,335 (GRCm39)	critical splice donor site	probably null
IGL01910:Calr	APN	8	85,571,598 (GRCm39)	unclassified	probably benign
IGL01918:Calr	APN	8	85,569,479 (GRCm39)	unclassified	probably benign
IGL02399:Calr	APN	8	85,569,415 (GRCm39)	unclassified	probably benign
IGL02749:Calr	APN	8	85,571,117 (GRCm39)	missense	probably damaging	1.00
IGL02858:Calr	APN	8	85,571,528 (GRCm39)	missense	probably benign	0.07
IGL03090:Calr	APN	8	85,573,373 (GRCm39)	missense	possibly damaging	0.82
K3955:Calr	UTSW	8	85,572,902 (GRCm39)	missense	probably damaging	1.00
R0309:Calr	UTSW	8	85,569,660 (GRCm39)	missense	probably benign	0.43
R1670:Calr	UTSW	8	85,570,748 (GRCm39)	missense	probably benign	0.24
R6864:Calr	UTSW	8	85,571,557 (GRCm39)	missense	probably damaging	0.98
R7120:Calr	UTSW	8	85,569,457 (GRCm39)	missense	probably damaging	0.98
R9320:Calr	UTSW	8	85,572,629 (GRCm39)	nonsense	probably null
Z1176:Calr	UTSW	8	85,570,693 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCGGACCATTTCAGAACAC -3'
(R):5'- CCTGAATACAAGGTAGGCTTGG -3'

Sequencing Primer
(F):5'- CCATTTCAGAACACCTTAGGGTTGG -3'
(R):5'- AATACAAGGTAGGCTTGGGTGTTTG -3'

Posted On

2014-08-25