Incidental Mutation 'R0138:Tcerg1'
ID22143
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
MMRRC Submission 038423-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0138 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 42568614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,105,449 N693K probably damaging Het
Adgrl3 T A 5: 81,693,607 V845D probably damaging Het
Anxa8 T A 14: 34,097,939 F269Y probably benign Het
Anxa8 T A 14: 34,097,940 F295L possibly damaging Het
Aox4 C G 1: 58,228,866 L202V probably damaging Het
Ap3s2 A G 7: 79,909,869 V104A probably benign Het
Aqp3 G A 4: 41,094,843 probably benign Het
Arhgef26 C T 3: 62,448,259 H751Y probably benign Het
Asic4 A T 1: 75,469,687 Q291L possibly damaging Het
Bap1 T C 14: 31,256,724 Y31H probably damaging Het
Brf1 A T 12: 112,961,139 V655D probably damaging Het
Cebpz A G 17: 78,931,391 S663P probably benign Het
Ces2h A G 8: 105,018,061 D357G probably benign Het
Cfap36 T C 11: 29,244,073 T90A probably benign Het
Ciita A T 16: 10,512,270 D803V probably damaging Het
Clnk C A 5: 38,774,608 probably benign Het
Cyp46a1 A G 12: 108,351,211 N158S probably damaging Het
Cyp4f13 A G 17: 32,941,106 I98T possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dll3 T A 7: 28,301,321 D103V possibly damaging Het
Dnaic1 T A 4: 41,629,814 M446K possibly damaging Het
Dppa4 A T 16: 48,291,062 T85S probably benign Het
Eif4g1 A T 16: 20,675,345 H57L probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fn1 T A 1: 71,624,110 Q1073L possibly damaging Het
Foxp4 T C 17: 47,869,179 D599G unknown Het
Frrs1 T C 3: 116,881,807 V128A possibly damaging Het
Gcfc2 G A 6: 81,949,954 D608N probably damaging Het
Gm1043 T C 5: 37,192,973 probably benign Het
Gm5148 T C 3: 37,714,777 E98G probably benign Het
Gpr141 T C 13: 19,752,258 I116V probably benign Het
Hic1 T C 11: 75,167,343 N240S probably damaging Het
Hpx G A 7: 105,592,238 T322I probably damaging Het
Hs3st4 A T 7: 124,397,193 M361L probably benign Het
Ifrd1 A G 12: 40,207,130 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Klk1b21 T A 7: 44,105,895 C173S probably damaging Het
Krt25 A T 11: 99,322,698 V65E probably benign Het
Lrrc15 A T 16: 30,273,449 D357E possibly damaging Het
Lrrd1 T A 5: 3,851,345 V550E probably benign Het
Macf1 A G 4: 123,440,747 Y1490H probably damaging Het
Macrod1 A G 19: 7,196,916 probably benign Het
Mcm5 T A 8: 75,120,880 V435D probably damaging Het
Mctp1 C T 13: 76,827,712 R478C probably damaging Het
Med10 T C 13: 69,811,698 probably benign Het
Mrpl4 T C 9: 21,008,592 Y280H probably benign Het
Msrb3 T C 10: 120,851,987 E61G probably damaging Het
Myo1c T C 11: 75,661,001 Y337H possibly damaging Het
Myo7b T A 18: 32,010,151 T165S probably damaging Het
Myrfl T A 10: 116,849,233 R81W probably damaging Het
Neil1 T C 9: 57,143,746 probably benign Het
Neto2 A G 8: 85,641,044 I357T possibly damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nkx6-3 T C 8: 23,153,591 S3P probably benign Het
Olfr652 A T 7: 104,565,003 I261L probably benign Het
Plce1 T C 19: 38,524,419 I54T possibly damaging Het
Prex2 A T 1: 11,285,043 probably benign Het
Psapl1 T A 5: 36,204,631 V189E probably damaging Het
Ptdss2 T G 7: 141,155,319 probably benign Het
Rnf213 T C 11: 119,416,496 C661R probably benign Het
Rpap1 T C 2: 119,764,899 probably null Het
Rrp1b A G 17: 32,060,452 T696A probably benign Het
Sacm1l T A 9: 123,548,917 H87Q probably benign Het
Serpinb11 T A 1: 107,377,530 M212K probably damaging Het
Tbc1d22a C A 15: 86,299,684 T248K probably damaging Het
Tpst1 T A 5: 130,101,786 H32Q probably damaging Het
Tsc2 A T 17: 24,599,626 V1412E possibly damaging Het
Usp19 C A 9: 108,501,315 P1326Q possibly damaging Het
Vmn1r235 T A 17: 21,262,334 M307K probably damaging Het
Vmn2r58 T A 7: 41,837,624 T616S probably damaging Het
Vps13a G A 19: 16,660,499 T2406I possibly damaging Het
Zbtb26 T A 2: 37,436,041 M328L probably benign Het
Zp2 A G 7: 120,137,200 F340S probably damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
tarantula UTSW 18 42536348 missense probably damaging 0.98
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42524008 missense unknown
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R4858:Tcerg1 UTSW 18 42523981 missense unknown
R5371:Tcerg1 UTSW 18 42519535 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 unclassified probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
R7147:Tcerg1 UTSW 18 42550063 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGAGTCTCATGGTTGATTGGGAAGACA -3'
(R):5'- AGTGTAGCCACCATCCAGAACGATAAT -3'

Sequencing Primer
(F):5'- tgtttgccactaccaccc -3'
(R):5'- ATGACCCTAAAGCAGCGTTTTC -3'
Posted On2013-04-12