Incidental Mutation 'R2033:Sun1'
ID221474
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
MMRRC Submission 040040-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2033 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139225438 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 149 (H149Y)
Ref Sequence ENSEMBL: ENSMUSP00000117679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000127045] [ENSMUST00000129079] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715] [ENSMUST00000148772]
Predicted Effect probably damaging
Transcript: ENSMUST00000058716
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078690
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100517
AA Change: H149Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110882
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110883
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110884
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127045
SMART Domains Protein: ENSMUSP00000123211
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129079
SMART Domains Protein: ENSMUSP00000119582
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:MRP 71 131 8.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135720
AA Change: H55Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817
AA Change: H55Y

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142473
Predicted Effect probably damaging
Transcript: ENSMUST00000143562
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146715
AA Change: H149Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817
AA Change: H149Y

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148772
SMART Domains Protein: ENSMUSP00000114869
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 64 76 N/A INTRINSIC
Pfam:MRP 103 176 1.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153469
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T C 4: 144,456,383 T172A probably benign Het
Atp6v1c1 T C 15: 38,673,966 probably null Het
Bpifc G A 10: 86,000,632 T3I possibly damaging Het
Car12 A G 9: 66,717,558 probably null Het
Ccrl2 A G 9: 111,055,870 F187L possibly damaging Het
Cep250 G A 2: 155,970,892 R544H probably damaging Het
Col4a3 T G 1: 82,718,011 probably benign Het
Cyb5r2 T C 7: 107,756,907 probably null Het
Elfn2 A G 15: 78,671,896 V817A probably damaging Het
Eln C T 5: 134,710,106 probably null Het
Eml5 T C 12: 98,791,386 E1896G possibly damaging Het
G530012D18Rik CACAGA CA 1: 85,577,154 probably null Het
Galnt11 C T 5: 25,247,538 T16I probably damaging Het
Gars C T 6: 55,077,723 H672Y probably benign Het
Gpr155 T A 2: 73,348,182 H726L probably benign Het
Inpp1 T A 1: 52,790,173 N229I possibly damaging Het
Isg20 A C 7: 78,916,533 I77L probably damaging Het
Kit G C 5: 75,637,317 D422H possibly damaging Het
Lonp2 A G 8: 86,708,942 E602G possibly damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Myh6 A C 14: 54,963,645 L120R probably benign Het
Myo18a T A 11: 77,843,099 probably null Het
Nphs2 T C 1: 156,323,738 V249A probably damaging Het
Npsr1 A G 9: 24,313,352 K342E probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nudt18 G T 14: 70,579,616 G162V possibly damaging Het
Odam A G 5: 87,892,419 D248G probably benign Het
Olfr1224-ps1 A G 2: 89,157,154 V7A probably damaging Het
Olfr147 G T 9: 38,403,373 M166I probably damaging Het
Olfr390 T C 11: 73,787,438 S167P probably benign Het
Olfr557 A G 7: 102,699,162 E308G probably benign Het
Olfr572 T C 7: 102,928,408 V260A probably benign Het
Pde4b G T 4: 102,605,295 D723Y probably benign Het
Pdzrn3 T C 6: 101,150,954 E917G probably damaging Het
Ppip5k1 C T 2: 121,337,627 R715H probably damaging Het
Prkdc T A 16: 15,687,352 probably benign Het
Ptp4a3 A G 15: 73,753,769 Y21C probably damaging Het
Ptprk C A 10: 28,592,767 probably benign Het
Rfesd C A 13: 76,002,872 probably null Het
Rtel1 A T 2: 181,351,863 K592* probably null Het
Siah1a T A 8: 86,725,270 K195N probably damaging Het
Slc5a5 G T 8: 70,888,587 D369E probably damaging Het
Slc6a6 A T 6: 91,724,910 I100F probably benign Het
Smtn T C 11: 3,517,781 I913V probably benign Het
Stk17b A G 1: 53,761,076 S248P probably damaging Het
Taar5 T C 10: 23,971,094 I130T possibly damaging Het
Tmem132b G T 5: 125,749,289 V448F probably damaging Het
Tmem94 C A 11: 115,794,328 N888K possibly damaging Het
Trpc1 T C 9: 95,706,843 N742S probably damaging Het
Ttbk2 T C 2: 120,806,849 T112A probably damaging Het
Tubb2a A T 13: 34,075,456 L117Q probably damaging Het
Vmn1r60 T A 7: 5,544,820 M94L probably benign Het
Vmn2r83 A G 10: 79,491,819 T754A probably benign Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139226588 missense probably damaging 0.97
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R0733:Sun1 UTSW 5 139231163 missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139238856 missense probably damaging 0.98
R1724:Sun1 UTSW 5 139235725 missense probably benign
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2200:Sun1 UTSW 5 139231219 missense probably benign 0.11
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGTAGGACAGTCAAACAGAG -3'
(R):5'- GAATGGCTGTAAGACTGCTGC -3'

Sequencing Primer
(F):5'- CAGTCAAACAGAGAAGAAGTGC -3'
(R):5'- AATCAGCCATGTTTCAGAGAGC -3'
Posted On2014-08-25