Incidental Mutation 'R1975:Gm973'
ID221510
Institutional Source Beutler Lab
Gene Symbol Gm973
Ensembl Gene ENSMUSG00000047361
Gene Namepredicted gene 973
SynonymsLOC381260
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59516264-59636417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59562771 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 515 (T515S)
Ref Sequence ENSEMBL: ENSMUSP00000109881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114243
AA Change: T515S

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109881
Gene: ENSMUSG00000047361
AA Change: T515S

DomainStartEndE-ValueType
low complexity region 364 375 N/A INTRINSIC
Pfam:DUF4670 583 1045 7.3e-160 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187979
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Gm973
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gm973 APN 1 59630279 missense probably benign 0.00
IGL01732:Gm973 APN 1 59630237 missense probably benign 0.24
IGL02124:Gm973 APN 1 59582473 nonsense probably null
IGL02251:Gm973 APN 1 59582423 missense probably benign 0.18
IGL02818:Gm973 APN 1 59541475 critical splice donor site probably null
IGL03385:Gm973 APN 1 59582470 missense probably benign 0.14
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0280:Gm973 UTSW 1 59544680 frame shift probably null
R0490:Gm973 UTSW 1 59558234 splice site probably benign
R0491:Gm973 UTSW 1 59558234 splice site probably benign
R0508:Gm973 UTSW 1 59582490 splice site probably benign
R0636:Gm973 UTSW 1 59551144 missense probably benign 0.13
R0709:Gm973 UTSW 1 59558234 splice site probably benign
R0900:Gm973 UTSW 1 59566668 missense probably benign 0.00
R1758:Gm973 UTSW 1 59634010 missense unknown
R1816:Gm973 UTSW 1 59582399 missense probably damaging 0.99
R2166:Gm973 UTSW 1 59526739 missense possibly damaging 0.61
R3052:Gm973 UTSW 1 59633140 splice site probably benign
R3899:Gm973 UTSW 1 59625140 missense probably benign 0.00
R4181:Gm973 UTSW 1 59551240 missense possibly damaging 0.93
R4302:Gm973 UTSW 1 59551240 missense possibly damaging 0.93
R4623:Gm973 UTSW 1 59556276 missense probably damaging 1.00
R4642:Gm973 UTSW 1 59558114 missense probably damaging 1.00
R4716:Gm973 UTSW 1 59552554 nonsense probably null
R4920:Gm973 UTSW 1 59627566 missense probably benign
R4951:Gm973 UTSW 1 59541474 critical splice donor site probably null
R5214:Gm973 UTSW 1 59526721 missense probably damaging 1.00
R5225:Gm973 UTSW 1 59562700 missense probably benign 0.01
R5472:Gm973 UTSW 1 59628287 splice site probably null
R5554:Gm973 UTSW 1 59526972 missense probably benign 0.09
R5709:Gm973 UTSW 1 59552555 missense possibly damaging 0.73
R5886:Gm973 UTSW 1 59558250 intron probably benign
R6044:Gm973 UTSW 1 59628234 missense probably benign
R6046:Gm973 UTSW 1 59632350 missense unknown
R6818:Gm973 UTSW 1 59630169 missense probably damaging 0.99
R6920:Gm973 UTSW 1 59552461 missense possibly damaging 0.76
R6999:Gm973 UTSW 1 59634092 missense unknown
R7214:Gm973 UTSW 1 59562729 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAAGATGCACGCTGATCTTC -3'
(R):5'- CAGGGGATGGCTGAACATTG -3'

Sequencing Primer
(F):5'- ACGCTGATCTTCCTGATTCAAAGG -3'
(R):5'- AGGGGATGGCTGAACATTGATTATTG -3'
Posted On2014-08-25