Incidental Mutation 'R1975:Ankar'
ID221512
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72658441 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1068 (V1068I)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053499
AA Change: V1068I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: V1068I

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000211837
AA Change: V1067I

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212573
AA Change: V850I

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 intron probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTTTGCAACAAAGGCCAC -3'
(R):5'- TGATGTAGTAGACACTGAAGTCC -3'

Sequencing Primer
(F):5'- TGTCACCATTTTAACTGACCAAG -3'
(R):5'- TGTAGTAGACACTGAAGTCCACACC -3'
Posted On2014-08-25