Incidental Mutation 'R1975:Olfr1053'
ID221518
Institutional Source Beutler Lab
Gene Symbol Olfr1053
Ensembl Gene ENSMUSG00000075192
Gene Nameolfactory receptor 1053
SynonymsGA_x6K02T2Q125-47793414-47792471, Olfr1053-ps1, MOR187-4
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86314343-86315284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 86315154 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 44 (G44A)
Ref Sequence ENSEMBL: ENSMUSP00000097481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099897]
Predicted Effect probably damaging
Transcript: ENSMUST00000099897
AA Change: G44A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097481
Gene: ENSMUSG00000075192
AA Change: G44A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-45 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Olfr1053
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr1053 APN 2 86314944 missense probably damaging 1.00
IGL02063:Olfr1053 APN 2 86314793 missense possibly damaging 0.50
IGL02503:Olfr1053 APN 2 86314639 missense possibly damaging 0.71
IGL03342:Olfr1053 APN 2 86315235 missense possibly damaging 0.85
PIT4520001:Olfr1053 UTSW 2 86314798 missense possibly damaging 0.78
R0562:Olfr1053 UTSW 2 86314525 missense probably benign 0.00
R1026:Olfr1053 UTSW 2 86315214 missense possibly damaging 0.80
R1134:Olfr1053 UTSW 2 86315181 missense probably damaging 1.00
R1200:Olfr1053 UTSW 2 86315133 missense probably damaging 0.99
R1566:Olfr1053 UTSW 2 86314785 missense probably benign 0.01
R1588:Olfr1053 UTSW 2 86314530 missense probably damaging 1.00
R1747:Olfr1053 UTSW 2 86314867 missense probably benign 0.00
R1951:Olfr1053 UTSW 2 86315160 missense probably damaging 1.00
R2291:Olfr1053 UTSW 2 86315180 nonsense probably null
R2425:Olfr1053 UTSW 2 86314395 missense probably damaging 0.98
R5092:Olfr1053 UTSW 2 86314362 missense probably benign 0.00
R5651:Olfr1053 UTSW 2 86314440 missense probably benign 0.23
R5733:Olfr1053 UTSW 2 86315214 missense probably damaging 0.98
R5767:Olfr1053 UTSW 2 86314398 missense probably damaging 1.00
R6307:Olfr1053 UTSW 2 86315124 missense probably benign
R6720:Olfr1053 UTSW 2 86315065 missense probably damaging 0.99
R7067:Olfr1053 UTSW 2 86314567 missense probably damaging 1.00
R7289:Olfr1053 UTSW 2 86315025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGGGTAGCACATTCACAG -3'
(R):5'- TTCCAACAAGATGAAGTTGCAG -3'

Sequencing Primer
(F):5'- CACATTCACAGAAAGAAATGGTTTTG -3'
(R):5'- GTTGCAGTCTAAAAACAAAGCTC -3'
Posted On2014-08-25