Incidental Mutation 'R1975:Cspg4'
ID221591
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 56890478 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1409 (G1409R)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably damaging
Transcript: ENSMUST00000035661
AA Change: G1409R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: G1409R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGGCATCTCTGTGGAGC -3'
(R):5'- TCCACAGGTAAGAAGTGTGTATG -3'

Sequencing Primer
(F):5'- GCATCTCTGTGGAGCTGGAG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCC -3'
Posted On2014-08-25