Incidental Mutation 'R1975:Dnah17'
ID221617
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Namedynein, axonemal, heavy chain 17
SynonymsLOC382552, Dnahcl1, 2810003K23Rik, Dnahc17
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118021723-118130634 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118096536 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1320 (L1320*)
Ref Sequence ENSEMBL: ENSMUSP00000120542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018719
SMART Domains Protein: ENSMUSP00000018719
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:AAA_6 146 168 2.5e-9 PFAM
low complexity region 174 188 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084803
AA Change: L1316*
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: L1316*

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106308
AA Change: L1316*
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: L1316*

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132685
AA Change: L1320*
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: L1320*

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Meta Mutation Damage Score 0.558 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dock4 T C 12: 40,779,642 probably benign Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 118088214 missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 118043173 missense probably damaging 0.97
IGL00764:Dnah17 APN 11 118096485 missense probably damaging 0.99
IGL00795:Dnah17 APN 11 118093634 missense probably benign 0.35
IGL00823:Dnah17 APN 11 118047161 missense probably benign 0.22
IGL01145:Dnah17 APN 11 118047173 missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 118049934 missense probably damaging 1.00
IGL01454:Dnah17 APN 11 118058397 missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118119568 missense probably damaging 1.00
IGL01548:Dnah17 APN 11 118098612 missense probably benign 0.21
IGL01557:Dnah17 APN 11 118073686 missense probably damaging 0.98
IGL01632:Dnah17 APN 11 118033881 missense probably damaging 1.00
IGL01636:Dnah17 APN 11 118041056 missense probably benign 0.03
IGL01672:Dnah17 APN 11 118042160 missense probably damaging 0.97
IGL01822:Dnah17 APN 11 118081993 missense probably damaging 1.00
IGL01869:Dnah17 APN 11 118052676 missense probably benign 0.09
IGL01916:Dnah17 APN 11 118125288 missense probably benign 0.00
IGL02131:Dnah17 APN 11 118072908 missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118124261 missense probably benign 0.01
IGL02220:Dnah17 APN 11 118072967 nonsense probably null
IGL02454:Dnah17 APN 11 118080767 missense probably damaging 0.98
IGL02458:Dnah17 APN 11 118036350 missense probably damaging 1.00
IGL02588:Dnah17 APN 11 118025653 missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 118073548 missense probably damaging 1.00
IGL02881:Dnah17 APN 11 118042118 missense probably damaging 1.00
IGL02952:Dnah17 APN 11 118088268 missense probably benign 0.03
IGL03382:Dnah17 APN 11 118081943 missense probably damaging 1.00
IGL03389:Dnah17 APN 11 118094979 missense probably damaging 1.00
ergos UTSW 11 118041158 splice site probably benign
watt UTSW 11 118080766 missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 118098582 missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 118060092 missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 118074434 missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 118058306 missense probably benign 0.01
R0157:Dnah17 UTSW 11 118127171 missense probably benign
R0320:Dnah17 UTSW 11 118052674 missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 118098539 missense probably benign 0.10
R0382:Dnah17 UTSW 11 118128996 missense probably damaging 1.00
R0383:Dnah17 UTSW 11 118067547 missense probably benign
R0400:Dnah17 UTSW 11 118082078 missense probably damaging 1.00
R0420:Dnah17 UTSW 11 118039939 missense probably damaging 1.00
R0483:Dnah17 UTSW 11 118047124 missense probably benign
R0533:Dnah17 UTSW 11 118110537 missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 118072900 missense probably damaging 1.00
R0564:Dnah17 UTSW 11 118082981 missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118121471 missense probably benign 0.00
R0608:Dnah17 UTSW 11 118090749 nonsense probably null
R0614:Dnah17 UTSW 11 118070568 splice site probably benign
R0632:Dnah17 UTSW 11 118067682 splice site probably benign
R0831:Dnah17 UTSW 11 118060271 missense probably damaging 0.99
R0838:Dnah17 UTSW 11 118060104 missense probably damaging 1.00
R0879:Dnah17 UTSW 11 118056835 splice site probably benign
R1061:Dnah17 UTSW 11 118052688 missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 118042175 missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118127137 critical splice donor site probably null
R1297:Dnah17 UTSW 11 118121366 splice site probably benign
R1332:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 118043215 missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118125606 splice site probably benign
R1418:Dnah17 UTSW 11 118074023 missense probably damaging 0.98
R1432:Dnah17 UTSW 11 118023327 missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118114233 missense probably damaging 1.00
R1500:Dnah17 UTSW 11 118101053 missense probably benign
R1506:Dnah17 UTSW 11 118125387 missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 118095015 missense probably benign
R1567:Dnah17 UTSW 11 118125985 missense probably damaging 1.00
R1597:Dnah17 UTSW 11 118103498 splice site probably benign
R1665:Dnah17 UTSW 11 118121495 splice site probably benign
R1703:Dnah17 UTSW 11 118026749 missense probably damaging 1.00
R1716:Dnah17 UTSW 11 118032598 missense probably benign 0.00
R1727:Dnah17 UTSW 11 118070489 missense probably damaging 0.98
R1727:Dnah17 UTSW 11 118096536 nonsense probably null
R1728:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 118069519 missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118121916 missense probably damaging 0.97
R1869:Dnah17 UTSW 11 118047189 nonsense probably null
R1886:Dnah17 UTSW 11 118108161 missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 118066968 missense probably benign 0.00
R1954:Dnah17 UTSW 11 118024731 missense probably damaging 1.00
R1969:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1971:Dnah17 UTSW 11 118104535 missense probably benign 0.00
R1977:Dnah17 UTSW 11 118112591 missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 118067531 missense probably benign 0.00
R2115:Dnah17 UTSW 11 118119802 missense probably benign 0.00
R2132:Dnah17 UTSW 11 118033747 missense probably damaging 0.98
R2200:Dnah17 UTSW 11 118102409 splice site probably benign
R2277:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 118096561 missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118126384 critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118125974 missense probably benign 0.10
R2497:Dnah17 UTSW 11 118087024 synonymous probably null
R2923:Dnah17 UTSW 11 118093547 missense probably damaging 1.00
R3121:Dnah17 UTSW 11 118041086 missense probably damaging 1.00
R3236:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3237:Dnah17 UTSW 11 118094854 missense probably benign 0.08
R3498:Dnah17 UTSW 11 118080849 splice site probably benign
R3499:Dnah17 UTSW 11 118080849 splice site probably benign
R3746:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3749:Dnah17 UTSW 11 118082916 missense probably benign 0.00
R3762:Dnah17 UTSW 11 118104526 missense probably benign 0.00
R3826:Dnah17 UTSW 11 118041158 splice site probably benign
R3828:Dnah17 UTSW 11 118041158 splice site probably benign
R3829:Dnah17 UTSW 11 118041158 splice site probably benign
R3877:Dnah17 UTSW 11 118024707 missense probably damaging 1.00
R3899:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 118094808 missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 118080849 splice site probably benign
R3913:Dnah17 UTSW 11 118080849 splice site probably benign
R3930:Dnah17 UTSW 11 118080849 splice site probably benign
R3931:Dnah17 UTSW 11 118080849 splice site probably benign
R3969:Dnah17 UTSW 11 118041158 splice site probably benign
R3970:Dnah17 UTSW 11 118041158 splice site probably benign
R4056:Dnah17 UTSW 11 118070538 missense probably benign 0.05
R4113:Dnah17 UTSW 11 118112594 missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118118772 missense probably damaging 1.00
R4324:Dnah17 UTSW 11 118094213 missense probably benign 0.01
R4412:Dnah17 UTSW 11 118073683 missense probably damaging 1.00
R4413:Dnah17 UTSW 11 118025168 missense probably benign 0.00
R4422:Dnah17 UTSW 11 118081973 missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 118052943 missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 118074293 missense probably benign 0.02
R4677:Dnah17 UTSW 11 118119814 missense probably damaging 1.00
R4716:Dnah17 UTSW 11 118073648 missense probably benign 0.02
R4832:Dnah17 UTSW 11 118026780 missense probably damaging 1.00
R4868:Dnah17 UTSW 11 118108212 missense probably benign 0.03
R4897:Dnah17 UTSW 11 118078593 missense probably damaging 1.00
R4928:Dnah17 UTSW 11 118027433 missense probably damaging 1.00
R4937:Dnah17 UTSW 11 118042154 missense probably damaging 1.00
R4957:Dnah17 UTSW 11 118074298 missense probably benign 0.44
R5008:Dnah17 UTSW 11 118110577 missense probably benign 0.01
R5016:Dnah17 UTSW 11 118080766 missense probably damaging 0.96
R5027:Dnah17 UTSW 11 118102539 missense probably benign 0.01
R5133:Dnah17 UTSW 11 118117113 missense probably benign 0.00
R5140:Dnah17 UTSW 11 118086945 missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118114179 missense probably damaging 0.99
R5151:Dnah17 UTSW 11 118027467 missense probably damaging 1.00
R5153:Dnah17 UTSW 11 118082974 nonsense probably null
R5192:Dnah17 UTSW 11 118034359 missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118127283 missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118112514 missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118117203 intron probably benign
R5396:Dnah17 UTSW 11 118127282 missense probably benign
R5418:Dnah17 UTSW 11 118094984 missense probably benign 0.04
R5534:Dnah17 UTSW 11 118052770 missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 118073660 missense probably benign 0.03
R5594:Dnah17 UTSW 11 118043229 splice site probably null
R5634:Dnah17 UTSW 11 118052926 splice site probably null
R5696:Dnah17 UTSW 11 118101056 missense probably benign 0.44
R5802:Dnah17 UTSW 11 118036446 missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 118034367 missense probably damaging 1.00
R5873:Dnah17 UTSW 11 118056897 missense probably benign 0.01
R5898:Dnah17 UTSW 11 118114213 missense probably benign 0.00
R5934:Dnah17 UTSW 11 118041102 missense probably benign
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6030:Dnah17 UTSW 11 118025549 missense probably benign 0.32
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6038:Dnah17 UTSW 11 118055889 missense probably benign 0.00
R6113:Dnah17 UTSW 11 118126275 missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118119571 missense probably benign 0.00
R6137:Dnah17 UTSW 11 118025654 missense probably damaging 1.00
R6173:Dnah17 UTSW 11 118039946 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118126323 nonsense probably null
R6258:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126322 missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118126323 nonsense probably null
R6260:Dnah17 UTSW 11 118126324 missense probably damaging 1.00
R6278:Dnah17 UTSW 11 118126290 missense probably damaging 0.99
R6298:Dnah17 UTSW 11 118108161 missense probably benign 0.00
R6300:Dnah17 UTSW 11 118034310 missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118129155 missense probably benign 0.09
R6363:Dnah17 UTSW 11 118110505 missense probably benign
R6381:Dnah17 UTSW 11 118129185 missense probably benign 0.08
R6418:Dnah17 UTSW 11 118129197 missense probably damaging 0.99
R6660:Dnah17 UTSW 11 118100188 missense probably benign
R6803:Dnah17 UTSW 11 118125372 missense probably benign 0.00
R6820:Dnah17 UTSW 11 118069000 missense probably damaging 0.99
R6885:Dnah17 UTSW 11 118090772 missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 118041484 missense probably damaging 0.98
R6932:Dnah17 UTSW 11 118060079 missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 118066432 missense probably damaging 1.00
R7000:Dnah17 UTSW 11 118025702 critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118118871 missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 118046118 missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118125386 missense probably benign
R7131:Dnah17 UTSW 11 118079658 missense probably benign 0.14
R7143:Dnah17 UTSW 11 118086130 missense probably damaging 1.00
R7146:Dnah17 UTSW 11 118082110 missense probably damaging 0.98
R7147:Dnah17 UTSW 11 118094929 missense probably benign 0.31
R7172:Dnah17 UTSW 11 118041131 nonsense probably null
R7183:Dnah17 UTSW 11 118129188 missense probably benign
R7297:Dnah17 UTSW 11 118055730 critical splice donor site probably null
R7297:Dnah17 UTSW 11 118103356 missense probably damaging 0.98
X0058:Dnah17 UTSW 11 118082925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCTGTGAAGACTATCCTTAG -3'
(R):5'- ACATCCTCCAGTAGCAGGTG -3'

Sequencing Primer
(F):5'- TTGGACAGGATTTGAGCCCTACC -3'
(R):5'- TCCAGTAGCAGGTGGAACC -3'
Posted On2014-08-25