Incidental Mutation 'R1975:Dock4'
ID221619
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 40779642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221731
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Eml4 T C 17: 83,410,193 S65P probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTTATTTAAGGCCACCGAGACGTG -3'
(R):5'- ACGATGTCAGTTTCTGGAGAC -3'

Sequencing Primer
(F):5'- CGAGACGTGTTCACTAGCTAC -3'
(R):5'- GACAGCTTTTGAGTGTGATAAAGAC -3'
Posted On2014-08-25