Incidental Mutation 'R1975:Eml4'
ID221651
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Nameechinoderm microtubule associated protein like 4
Synonyms4930443C24Rik
MMRRC Submission 039988-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R1975 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83350931-83480361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83410193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 65 (S65P)
Ref Sequence ENSEMBL: ENSMUSP00000107982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
Predicted Effect probably benign
Transcript: ENSMUST00000049503
AA Change: S65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624
AA Change: S65P

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096766
AA Change: S65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: S65P

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112363
AA Change: S65P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624
AA Change: S65P

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,604,259 T429A probably benign Het
Afmid A C 11: 117,836,474 I275L probably benign Het
Aimp1 A C 3: 132,677,099 D5E possibly damaging Het
Aldob G A 4: 49,538,171 A319V probably benign Het
Ankar C T 1: 72,658,441 V1068I possibly damaging Het
Ccr2 C T 9: 124,106,793 S370L probably benign Het
Chrnb4 A G 9: 55,034,818 Y391H probably damaging Het
Clip1 A G 5: 123,623,218 M873T possibly damaging Het
Cspg4 G C 9: 56,890,478 G1409R probably damaging Het
Dnah17 A T 11: 118,096,536 L1320* probably null Het
Dock4 T C 12: 40,779,642 probably benign Het
Fblim1 A T 4: 141,584,864 D183E probably damaging Het
Foxn1 T C 11: 78,365,937 probably benign Het
Gm973 A T 1: 59,562,771 T515S possibly damaging Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Hipk3 T C 2: 104,471,173 I225V probably benign Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Il15ra A G 2: 11,723,523 T133A possibly damaging Het
Krt78 T C 15: 101,946,168 *1069W probably null Het
Lama3 T A 18: 12,453,863 M761K probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Macf1 T C 4: 123,489,212 T1320A probably damaging Het
Mark3 A T 12: 111,615,441 I115L probably damaging Het
Mcph1 T G 8: 18,689,065 probably benign Het
Med23 T A 10: 24,910,766 N923K probably benign Het
Msrb2 T G 2: 19,393,221 Y97D probably damaging Het
Muc6 C T 7: 141,648,101 G708S probably damaging Het
Mylk T C 16: 34,880,303 probably null Het
Nfrkb T A 9: 31,414,684 V1141E possibly damaging Het
Obscn T C 11: 59,067,729 E3675G probably damaging Het
Olfr1053 C G 2: 86,315,154 G44A probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr203 T C 16: 59,303,728 S193P probably damaging Het
Olfr612 A T 7: 103,538,994 F80Y probably damaging Het
Olfr619 A G 7: 103,604,012 probably null Het
Olfr720 A T 14: 14,175,446 V212E probably damaging Het
Olfr746 T A 14: 50,653,364 N42K probably damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pkhd1l1 G T 15: 44,529,713 V1815F probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Psma8 T G 18: 14,730,976 probably null Het
Rbl2 T C 8: 91,085,462 S220P probably benign Het
Rere T A 4: 150,615,733 D1091E probably damaging Het
Rpa1 A G 11: 75,306,176 C540R probably damaging Het
Sema3d T A 5: 12,563,318 V454E probably damaging Het
Sema3d T C 5: 12,584,998 V677A probably benign Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sirpb1a T C 3: 15,379,081 I370V probably benign Het
Slc22a19 A G 19: 7,683,859 probably benign Het
Slc26a1 T A 5: 108,672,472 D287V probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Slco2a1 T A 9: 103,079,454 Y488* probably null Het
Stab2 A C 10: 86,896,496 probably null Het
Strn T C 17: 78,692,499 probably null Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Thumpd3 A G 6: 113,055,877 N192S possibly damaging Het
Tns3 T A 11: 8,435,738 I1386F probably benign Het
Treml4 T A 17: 48,272,793 V219E probably damaging Het
Triobp T C 15: 78,966,708 V354A probably benign Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Tub G A 7: 109,027,835 G314R possibly damaging Het
Ube3b C T 5: 114,399,865 T339M possibly damaging Het
Vmn2r43 A G 7: 8,255,551 I221T possibly damaging Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Zfp110 C T 7: 12,848,502 T359I probably benign Het
Zfp322a A T 13: 23,356,904 C223S probably damaging Het
Zfp512b G A 2: 181,587,085 R696* probably null Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83448184 missense probably benign 0.05
IGL00815:Eml4 APN 17 83450790 splice site probably benign
IGL01969:Eml4 APN 17 83445980 missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83477703 splice site probably benign
IGL02273:Eml4 APN 17 83456379 splice site probably null
IGL02318:Eml4 APN 17 83441366 missense probably benign 0.01
IGL02421:Eml4 APN 17 83477892 missense probably benign 0.00
IGL02728:Eml4 APN 17 83473139 splice site probably null
IGL02814:Eml4 APN 17 83441362 nonsense probably null
IGL02900:Eml4 APN 17 83477992 missense probably benign 0.00
IGL03205:Eml4 APN 17 83454444 missense probably damaging 1.00
erring UTSW 17 83448217 missense probably damaging 1.00
R0147:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0148:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0440:Eml4 UTSW 17 83446058 critical splice donor site probably null
R0541:Eml4 UTSW 17 83440042 missense probably benign 0.00
R0645:Eml4 UTSW 17 83463493 splice site probably benign
R0733:Eml4 UTSW 17 83454464 missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83478060 missense probably benign 0.08
R1071:Eml4 UTSW 17 83478039 nonsense probably null
R2042:Eml4 UTSW 17 83448178 missense probably damaging 0.97
R2229:Eml4 UTSW 17 83451056 missense probably benign 0.05
R2257:Eml4 UTSW 17 83477760 missense probably damaging 0.99
R2878:Eml4 UTSW 17 83410174 missense probably benign 0.01
R3820:Eml4 UTSW 17 83473065 missense probably damaging 1.00
R4466:Eml4 UTSW 17 83421674 nonsense probably null
R4620:Eml4 UTSW 17 83461533 missense probably benign 0.13
R4657:Eml4 UTSW 17 83450948 nonsense probably null
R4717:Eml4 UTSW 17 83448225 missense probably benign 0.38
R4740:Eml4 UTSW 17 83410030 missense probably damaging 1.00
R5073:Eml4 UTSW 17 83463577 missense probably damaging 1.00
R5699:Eml4 UTSW 17 83410085 missense probably benign 0.16
R5834:Eml4 UTSW 17 83477741 missense probably damaging 1.00
R5944:Eml4 UTSW 17 83446043 missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R6378:Eml4 UTSW 17 83448217 missense probably damaging 1.00
R6980:Eml4 UTSW 17 83451017 missense probably benign 0.00
R7025:Eml4 UTSW 17 83425311 missense probably benign 0.04
R7037:Eml4 UTSW 17 83425327 missense probably benign 0.04
R7042:Eml4 UTSW 17 83461570 missense probably damaging 0.99
R7192:Eml4 UTSW 17 83454461 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGTAATTTTCTCACCAGAAGG -3'
(R):5'- TATGGTGGAGGAGCCTAAGC -3'

Sequencing Primer
(F):5'- GGAAATTCTTTCTTGAACAGTCTGG -3'
(R):5'- CCTAAGCCTGTAAGGGATGTC -3'
Posted On2014-08-25