Incidental Mutation 'R1976:Micu1'
ID221731
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Namemitochondrial calcium uptake 1
SynonymsC730016L05Rik, Cbara1
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59702477-59864132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59768213 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 174 (S174P)
Ref Sequence ENSEMBL: ENSMUSP00000131000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000171409] [ENSMUST00000179709]
Predicted Effect probably damaging
Transcript: ENSMUST00000020311
AA Change: S213P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: S213P

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092508
AA Change: S211P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: S211P

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165563
AA Change: S207P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: S207P

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171409
AA Change: S174P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131000
Gene: ENSMUSG00000020111
AA Change: S174P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 61 N/A INTRINSIC
Pfam:EF-hand_6 191 221 1.8e-6 PFAM
Pfam:EF-hand_5 192 216 5.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172034
Predicted Effect probably damaging
Transcript: ENSMUST00000179709
AA Change: S207P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: S207P

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59863278 missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59839736 missense probably damaging 1.00
IGL03183:Micu1 APN 10 59728048 nonsense probably null
R0025:Micu1 UTSW 10 59788877 critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59839681 missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59756727 intron probably benign
R1121:Micu1 UTSW 10 59788982 missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59788976 missense probably damaging 1.00
R1762:Micu1 UTSW 10 59863260 missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59733161 splice site probably benign
R2082:Micu1 UTSW 10 59863307 missense probably benign 0.00
R2152:Micu1 UTSW 10 59863288 missense probably benign 0.01
R2395:Micu1 UTSW 10 59863202 nonsense probably null
R3619:Micu1 UTSW 10 59768258 splice site probably null
R3953:Micu1 UTSW 10 59750504 missense probably benign 0.01
R4809:Micu1 UTSW 10 59740822 missense probably benign
R4948:Micu1 UTSW 10 59863254 missense possibly damaging 0.56
R5103:Micu1 UTSW 10 59788984 missense possibly damaging 0.79
R5137:Micu1 UTSW 10 59827232 missense probably benign 0.20
R5431:Micu1 UTSW 10 59750521 missense possibly damaging 0.92
R5805:Micu1 UTSW 10 59827306 missense possibly damaging 0.46
R6910:Micu1 UTSW 10 59740667 missense probably damaging 1.00
R7030:Micu1 UTSW 10 59789021 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCGTCCTAGAAGTGCTTAG -3'
(R):5'- TCCTTTCAAGAGAGTTTACACCC -3'

Sequencing Primer
(F):5'- CGTCCTAGAAGTGCTTAGGGGAC -3'
(R):5'- GAGAGTTTACACCCAAATTACAGAAG -3'
Posted On2014-08-25