Mutagenetix > Incidental Mutations

Incidental Mutation 'R1976:Sacs'

221767

Institutional Source

Beutler Lab

Gene Symbol

Sacs

Ensembl Gene

ENSMUSG00000048279

Gene Name

sacsin

Synonyms

E130115J16Rik

MMRRC Submission

039989-MU

Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R1976 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61138457-61240695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61202895 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 797 (T797A)

Ref Sequence

ENSEMBL: ENSMUSP00000113377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]

Predicted Effect

probably benign
Transcript: ENSMUST00000089394

SMART Domains

Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119509

SMART Domains

Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

Domain	Start	End	E-Value	Type
SCOP:d1lm8b_	8	66	3e-3	SMART
Blast:UBQ	9	81	3e-31	BLAST
SCOP:d1byqa_	87	202	5e-3	SMART
Blast:HATPase_c	116	211	2e-10	BLAST
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119943
AA Change: T797A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: T797A

Domain	Start	End	E-Value	Type
internal_repeat_1	61	514	1.35e-52	PROSPERO
low complexity region	608	623	N/A	INTRINSIC
low complexity region	664	673	N/A	INTRINSIC
low complexity region	1019	1033	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1526	1537	N/A	INTRINSIC
low complexity region	2454	2463	N/A	INTRINSIC
internal_repeat_1	2475	2934	1.35e-52	PROSPERO
low complexity region	3751	3760	N/A	INTRINSIC
low complexity region	3997	4012	N/A	INTRINSIC
low complexity region	4285	4300	N/A	INTRINSIC
Blast:DnaJ	4304	4363	1e-31	BLAST
PDB:1IUR\|A	4309	4376	5e-39	PDB
SCOP:d1gh6a_	4317	4407	2e-3	SMART
HEPN	4454	4570	9.49e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150222

Predicted Effect

probably benign
Transcript: ENSMUST00000227570

Predicted Effect

probably benign
Transcript: ENSMUST00000229692

Meta Mutation Damage Score

0.11

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	C	7: 34,257,380	N353K	probably damaging	Het
Abca13	T	C	11: 9,397,815	V3556A	probably damaging	Het
Abcb5	T	C	12: 118,890,682	I833V	probably benign	Het
Adgrd1	A	T	5: 129,140,797	H432L	probably benign	Het
Alppl2	T	A	1: 87,088,741	I204F	probably damaging	Het
Ascc3	T	A	10: 50,649,166	F486I	probably damaging	Het
Bcl9l	T	A	9: 44,506,152	L429Q	possibly damaging	Het
Ccdc33	A	T	9: 58,117,162	Y227*	probably null	Het
Cd101	A	G	3: 101,008,061	V730A	probably damaging	Het
Cdadc1	A	T	14: 59,573,768	V431E	probably damaging	Het
Dazap1	T	A	10: 80,274,620		probably null	Het
Dbpht2	T	A	12: 74,295,861		noncoding transcript	Het
Dennd4b	A	T	3: 90,273,055	T742S	probably damaging	Het
Dhtkd1	T	C	2: 5,902,391	E838G	possibly damaging	Het
Dync2h1	A	T	9: 7,129,045	D1823E	probably benign	Het
Enox1	T	A	14: 77,668,793	N556K	probably benign	Het
Fam227a	T	C	15: 79,626,276	I392M	possibly damaging	Het
Fnip2	A	T	3: 79,480,931	M831K	probably benign	Het
Foxn1	T	C	11: 78,365,937		probably benign	Het
Glis3	T	C	19: 28,262,677		probably benign	Het
Gm4953	T	A	1: 159,168,353		noncoding transcript	Het
Gsr	T	G	8: 33,680,260		probably null	Het
Habp4	G	T	13: 64,184,606	V344F	probably benign	Het
Hdac7	G	A	15: 97,806,505	Q495*	probably null	Het
Helb	T	C	10: 120,094,263	D737G	possibly damaging	Het
Hltf	A	G	3: 20,106,446	D759G	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itsn2	A	G	12: 4,672,733		probably benign	Het
Kank2	A	T	9: 21,794,561	V387E	probably damaging	Het
Lefty1	T	C	1: 180,937,824	V319A	probably benign	Het
Lonp1	T	C	17: 56,615,068	T771A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,850	K348N	possibly damaging	Het
Lsamp	T	C	16: 41,889,067	V103A	probably damaging	Het
Ltbp4	A	T	7: 27,326,770	C538S	probably damaging	Het
Micu1	T	C	10: 59,768,213	S174P	probably damaging	Het
Mta1	A	G	12: 113,136,306	N607S	probably damaging	Het
Muc5b	C	T	7: 141,863,154	S3279L	probably benign	Het
Naalad2	T	C	9: 18,378,699	E211G	probably damaging	Het
Nup155	T	A	15: 8,135,827	M649K	probably benign	Het
Pan2	T	C	10: 128,320,413	V1171A	probably damaging	Het
Pisd	A	G	5: 32,738,865	V372A	probably damaging	Het
Prim1	T	A	10: 128,023,799	C288S	probably benign	Het
Rab23	T	A	1: 33,723,938	C30S	probably damaging	Het
Sall3	T	C	18: 80,971,893	D940G	probably benign	Het
Scn1a	T	C	2: 66,331,271	E311G	probably benign	Het
Sdk1	T	A	5: 142,143,818	I1598N	probably damaging	Het
Slc22a17	A	T	14: 54,908,500		probably null	Het
Slc36a4	T	A	9: 15,734,210	V311D	probably damaging	Het
Sprr3	T	A	3: 92,456,946	Q197L	possibly damaging	Het
Stab2	A	C	10: 86,896,496		probably null	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tas2r123	T	A	6: 132,847,332	V64D	probably damaging	Het
Trhde	T	G	10: 114,588,431	N483T	possibly damaging	Het
Trp53	C	T	11: 69,588,497	T167M	probably damaging	Het
Tspan8	A	G	10: 115,844,130	I217V	probably benign	Het
Usp17la	A	G	7: 104,860,320	E44G	possibly damaging	Het
Usp40	T	G	1: 87,978,536	Q659P	probably benign	Het
Vmn1r4	T	C	6: 56,956,738	C76R	probably damaging	Het
Vmn2r118	C	T	17: 55,592,925	G660R	probably damaging	Het
Zcchc11	T	C	4: 108,479,523	L148P	probably benign	Het
Zfp786	T	A	6: 47,819,757	H749L	probably damaging	Het

Other mutations in Sacs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Sacs	APN	14	61191635	missense	possibly damaging	0.64
IGL01839:Sacs	APN	14	61183945	intron	probably benign
IGL02024:Sacs	APN	14	61189678	missense	probably damaging	0.96
IGL02247:Sacs	APN	14	61192535	missense	probably damaging	1.00
F6893:Sacs	UTSW	14	61212976	missense	probably benign
IGL03052:Sacs	UTSW	14	61207858	missense	probably damaging	0.99
R0090:Sacs	UTSW	14	61205440	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0102:Sacs	UTSW	14	61204568	missense	probably damaging	1.00
R0390:Sacs	UTSW	14	61205640	missense	possibly damaging	0.92
R0479:Sacs	UTSW	14	61191479	missense	probably damaging	0.99
R0556:Sacs	UTSW	14	61183958	missense	probably damaging	0.99
R0673:Sacs	UTSW	14	61210215	missense	possibly damaging	0.89
R0748:Sacs	UTSW	14	61209265	missense	probably damaging	0.99
R0931:Sacs	UTSW	14	61203495	missense	probably benign
R0972:Sacs	UTSW	14	61211963	nonsense	probably null
R1281:Sacs	UTSW	14	61191801	missense	probably benign	0.02
R1340:Sacs	UTSW	14	61204509	missense	probably damaging	0.98
R1351:Sacs	UTSW	14	61202761	missense	probably benign	0.00
R1499:Sacs	UTSW	14	61213704	missense	possibly damaging	0.70
R1538:Sacs	UTSW	14	61210059	missense	probably damaging	0.98
R1581:Sacs	UTSW	14	61213679	missense	probably damaging	0.96
R1599:Sacs	UTSW	14	61203638	missense	probably benign
R1631:Sacs	UTSW	14	61210732	nonsense	probably null
R1635:Sacs	UTSW	14	61203828	missense	probably damaging	0.98
R1655:Sacs	UTSW	14	61191782	missense	probably benign
R1660:Sacs	UTSW	14	61209009	missense	probably damaging	0.99
R1707:Sacs	UTSW	14	61209762	missense	probably benign	0.01
R1733:Sacs	UTSW	14	61205454	missense	probably damaging	1.00
R1772:Sacs	UTSW	14	61210897	missense	probably damaging	1.00
R2055:Sacs	UTSW	14	61214049	missense	probably damaging	0.97
R2083:Sacs	UTSW	14	61206506	missense	possibly damaging	0.69
R2091:Sacs	UTSW	14	61191919	missense	possibly damaging	0.95
R2105:Sacs	UTSW	14	61173441	missense	possibly damaging	0.90
R2109:Sacs	UTSW	14	61173453	splice site	probably null
R2117:Sacs	UTSW	14	61213771	missense	probably benign	0.01
R2122:Sacs	UTSW	14	61212316	missense	probably damaging	1.00
R2148:Sacs	UTSW	14	61173378	missense	probably damaging	0.97
R2151:Sacs	UTSW	14	61209640	missense	probably damaging	1.00
R2231:Sacs	UTSW	14	61205929	unclassified	probably null
R2248:Sacs	UTSW	14	61212802	missense	probably damaging	1.00
R2271:Sacs	UTSW	14	61204660	missense	probably benign	0.06
R2314:Sacs	UTSW	14	61207759	missense	probably benign	0.17
R2436:Sacs	UTSW	14	61202905	missense	possibly damaging	0.94
R2445:Sacs	UTSW	14	61205206	missense	probably damaging	1.00
R2512:Sacs	UTSW	14	61203080	missense	probably benign	0.00
R3434:Sacs	UTSW	14	61212303	missense	probably damaging	1.00
R3785:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3786:Sacs	UTSW	14	61183961	missense	probably damaging	1.00
R3796:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3798:Sacs	UTSW	14	61206121	missense	possibly damaging	0.87
R3872:Sacs	UTSW	14	61148068	missense	probably benign	0.30
R3873:Sacs	UTSW	14	61192286	missense	possibly damaging	0.64
R3892:Sacs	UTSW	14	61204387	missense	probably damaging	0.98
R4184:Sacs	UTSW	14	61213944	missense	probably damaging	0.97
R4204:Sacs	UTSW	14	61173443	missense	possibly damaging	0.93
R4249:Sacs	UTSW	14	61203457	missense	probably benign	0.02
R4256:Sacs	UTSW	14	61206337	missense	probably damaging	1.00
R4370:Sacs	UTSW	14	61212309	missense	probably damaging	1.00
R4445:Sacs	UTSW	14	61204686	missense	probably benign	0.30
R4503:Sacs	UTSW	14	61207603	missense	probably damaging	1.00
R4548:Sacs	UTSW	14	61191938	missense	probably damaging	1.00
R4582:Sacs	UTSW	14	61191698	missense	probably damaging	1.00
R4613:Sacs	UTSW	14	61211797	intron	probably null
R4639:Sacs	UTSW	14	61207268	missense	probably benign	0.12
R4697:Sacs	UTSW	14	61212747	missense	probably benign	0.19
R4706:Sacs	UTSW	14	61204273	missense	probably damaging	1.00
R4717:Sacs	UTSW	14	61212855	missense	probably damaging	1.00
R4777:Sacs	UTSW	14	61211809	missense	probably damaging	1.00
R4888:Sacs	UTSW	14	61212198	missense	probably damaging	1.00
R4913:Sacs	UTSW	14	61213797	missense	probably benign	0.17
R4973:Sacs	UTSW	14	61213122	missense	probably damaging	1.00
R4986:Sacs	UTSW	14	61213043	nonsense	probably null
R5090:Sacs	UTSW	14	61205253	missense	probably damaging	1.00
R5243:Sacs	UTSW	14	61205957	nonsense	probably null
R5292:Sacs	UTSW	14	61211983	missense	probably damaging	1.00
R5308:Sacs	UTSW	14	61192400	missense	probably benign	0.21
R5337:Sacs	UTSW	14	61193514	intron	probably benign
R5502:Sacs	UTSW	14	61206100	missense	probably damaging	1.00
R5586:Sacs	UTSW	14	61206441	nonsense	probably null
R5692:Sacs	UTSW	14	61207839	missense	probably benign	0.00
R5725:Sacs	UTSW	14	61211110	missense	probably damaging	1.00
R5854:Sacs	UTSW	14	61211547	missense	probably damaging	1.00
R5959:Sacs	UTSW	14	61212400	missense	probably damaging	0.99
R5960:Sacs	UTSW	14	61208695	missense	probably benign	0.30
R5968:Sacs	UTSW	14	61189629	missense	probably damaging	0.99
R5983:Sacs	UTSW	14	61205199	missense	probably damaging	1.00
R5992:Sacs	UTSW	14	61205543	missense	probably damaging	1.00
R6076:Sacs	UTSW	14	61204536	nonsense	probably null
R6175:Sacs	UTSW	14	61212826	missense	possibly damaging	0.82
R6347:Sacs	UTSW	14	61211160	missense	probably damaging	1.00
R6357:Sacs	UTSW	14	61208824	missense	possibly damaging	0.47
R6415:Sacs	UTSW	14	61205359	missense	probably damaging	1.00
R6469:Sacs	UTSW	14	61191248	missense	probably damaging	1.00
R6503:Sacs	UTSW	14	61211361	missense	probably benign	0.00
R6523:Sacs	UTSW	14	61202961	missense	probably damaging	0.99
R6615:Sacs	UTSW	14	61208934	missense	probably benign	0.15
R6729:Sacs	UTSW	14	61210518	missense	probably damaging	1.00
R6731:Sacs	UTSW	14	61180700	intron	probably null
R6797:Sacs	UTSW	14	61213073	missense	probably damaging	1.00
R6852:Sacs	UTSW	14	61179288	missense	possibly damaging	0.87
R6922:Sacs	UTSW	14	61211425	missense	probably damaging	1.00
X0067:Sacs	UTSW	14	61208019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCATGTACTCAGCTGCAG -3'
(R):5'- GTGGATGCTGAATAGAGGTATCTAG -3'

Sequencing Primer
(F):5'- CAGCTTCTAAATCCAGAGCGATTTGC -3'
(R):5'- GGTATCTAGTCTTTTCAGGACAATCC -3'

Posted On

2014-08-25