Incidental Mutation 'R1977:Lgr4'
ID221795
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 039990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110011928 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 729 (I729F)
Ref Sequence ENSEMBL: ENSMUSP00000106666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably damaging
Transcript: ENSMUST00000046548
AA Change: I753F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: I753F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111037
AA Change: I729F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: I729F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif2ak4 A T 2: 118,461,757 K1185* probably null Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0200:Lgr4 UTSW 2 109970690 critical splice acceptor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1367:Lgr4 UTSW 2 109991135 missense probably damaging 0.98
R1864:Lgr4 UTSW 2 110011397 missense possibly damaging 0.93
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2380:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3843:Lgr4 UTSW 2 109996773 splice site probably benign
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GTGCTTGCCATTTCCTACAGG -3'
(R):5'- CTGATCCGTGTTTCCTGGTGAC -3'

Sequencing Primer
(F):5'- TTGCCATTTCCTACAGGAGAGAC -3'
(R):5'- AGGAGCTTCCAGTCGTCTTTAAAC -3'
Posted On2014-08-25