Incidental Mutation 'R1977:Eif2ak4'
ID221797
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission 039990-MU
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1977 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118461757 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1185 (K1185*)
Ref Sequence ENSEMBL: ENSMUSP00000106498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]
Predicted Effect probably null
Transcript: ENSMUST00000005233
AA Change: K1263*
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: K1263*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102527
AA Change: K1151*
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: K1151*

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110870
AA Change: K985*
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: K985*

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110872
AA Change: K1142*
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: K1142*

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110874
AA Change: K1185*
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: K1185*

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125281
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 G T 8: 122,781,533 C256F probably damaging Het
Adgra2 T A 8: 27,115,761 V647D possibly damaging Het
AI593442 A T 9: 52,678,192 S28R probably damaging Het
Akr1c21 G C 13: 4,574,212 G22R probably damaging Het
Ampd3 T C 7: 110,803,162 W458R probably damaging Het
Arhgap23 G T 11: 97,451,447 R185L possibly damaging Het
Arhgap45 A T 10: 80,020,818 I67F probably damaging Het
Asah1 A G 8: 41,343,517 probably null Het
Atl2 A G 17: 79,852,590 Y56H probably damaging Het
Carf A T 1: 60,146,136 I447F probably damaging Het
Crmp1 A G 5: 37,276,283 N162S probably damaging Het
Cyp2a5 A G 7: 26,835,922 E103G probably benign Het
Cyp2c40 T C 19: 39,778,041 D370G probably damaging Het
Dhrs2 T A 14: 55,234,655 M1K probably null Het
Dnah17 T C 11: 118,112,591 E810G possibly damaging Het
E2f5 T A 3: 14,587,356 I84N probably damaging Het
Eif4ebp1 T A 8: 27,275,101 M115K probably damaging Het
Evi5 A T 5: 107,799,139 L505* probably null Het
Fbxw25 T A 9: 109,652,856 Y254F possibly damaging Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gps1 A G 11: 120,785,826 T124A probably damaging Het
Hopx T C 5: 77,117,616 probably benign Het
Hoxd3 A G 2: 74,744,276 S89G possibly damaging Het
Hrc A T 7: 45,336,214 D263V probably damaging Het
Hs6st3 T C 14: 119,138,476 I21T probably benign Het
Izumo4 A G 10: 80,703,121 Y106C probably damaging Het
Lama2 A T 10: 26,990,800 probably null Het
Lcorl A C 5: 45,775,420 S123R probably null Het
Lgr4 A T 2: 110,011,928 I729F probably damaging Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Matn3 T A 12: 8,961,110 probably benign Het
Mdc1 T A 17: 35,850,930 S912T probably benign Het
Mgam G A 6: 40,664,880 V556I probably benign Het
Myom2 A T 8: 15,085,263 I489F possibly damaging Het
Nfatc2 G A 2: 168,504,459 T905I possibly damaging Het
Nme6 G A 9: 109,835,341 R6Q probably damaging Het
Nr1h5 A G 3: 102,947,817 S323P probably damaging Het
Nr4a3 C A 4: 48,056,539 R364S probably damaging Het
Obox7 A T 7: 14,664,398 D79V probably damaging Het
Olfr167 G A 16: 19,514,836 P267S probably damaging Het
Olfr374 G A 8: 72,109,854 G96D probably benign Het
Olfr435 T A 6: 43,201,980 V112D possibly damaging Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Parp8 T A 13: 116,910,913 I208F probably damaging Het
Pdgfc C T 3: 81,209,245 T302I probably damaging Het
Pnpt1 A G 11: 29,141,256 I337V probably benign Het
Polk T C 13: 96,489,228 E436G probably damaging Het
Pramel7 A G 2: 87,491,121 V190A probably benign Het
Rplp2 T C 7: 141,448,781 probably benign Het
Sec23ip T A 7: 128,766,273 S670T probably damaging Het
Sgk2 A G 2: 163,004,160 N207S probably benign Het
Sh2d2a C T 3: 87,851,816 Q242* probably null Het
Sh3pxd2b A C 11: 32,422,138 N435T probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Stx17 G A 4: 48,181,553 V241M probably benign Het
Taok3 A T 5: 117,265,924 K721N probably damaging Het
Tbxas1 A G 6: 38,948,641 probably benign Het
Tmem87a G A 2: 120,374,504 A377V probably benign Het
Topaz1 C T 9: 122,747,362 T6M unknown Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Vmn2r125 A G 4: 156,354,591 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Wdr59 A T 8: 111,458,638 C888S probably benign Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTAGGACTAGCAAAGGC -3'
(R):5'- TTATCACTGCAGGCCCAAAC -3'

Sequencing Primer
(F):5'- GGATTACCTGTGACCACCCAATG -3'
(R):5'- CTGCCAGCACAGAACAGC -3'
Posted On2014-08-25