Incidental Mutation 'R2045:Bag4'
ID221834
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25769488 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 228 (A228T)
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
AA Change: A228T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316
AA Change: A228T

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1103:Bag4 UTSW 8 25767863 utr 3 prime probably benign
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4467:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4541:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4708:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6084:Bag4 UTSW 8 25771231 missense probably benign 0.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTTAGGCTGCTGAGGTG -3'
(R):5'- TGGGAGCCAGGTTTTCTCAG -3'

Sequencing Primer
(F):5'- CTGCTGAGGTGGGGGTGAAG -3'
(R):5'- CTCAGGTGTGGAGAACTTTTGGTAAC -3'
Posted On2014-08-25