Incidental Mutation 'R2045:Itgb3'
ID221860
Institutional Source Beutler Lab
Gene Symbol Itgb3
Ensembl Gene ENSMUSG00000020689
Gene Nameintegrin beta 3
SynonymsCD61, platelet glycoprotein IIIa (GP3A)
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104608000-104670476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104623413 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 27 (S27A)
Ref Sequence ENSEMBL: ENSMUSP00000021028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021028]
Predicted Effect probably benign
Transcript: ENSMUST00000021028
AA Change: S27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021028
Gene: ENSMUSG00000020689
AA Change: S27A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
PSI 29 75 4.43e-5 SMART
INB 37 460 3.16e-276 SMART
VWA 136 395 8.65e-2 SMART
Pfam:EGF_2 511 546 6.8e-7 PFAM
Pfam:EGF_2 553 583 8.1e-7 PFAM
Integrin_B_tail 633 717 1.07e-28 SMART
Integrin_b_cyt 741 787 1.78e-25 SMART
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit platelet defects, extended bleeding times, cutaneous and gastrointestinal bleeding, anemia, increased bone mass, hypocalcemia, reduced survival, and placental defects associated with some fetal loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Itgb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itgb3 APN 11 104633584 missense probably damaging 1.00
IGL01460:Itgb3 APN 11 104662394 nonsense probably null
IGL01615:Itgb3 APN 11 104643965 missense probably damaging 1.00
IGL01669:Itgb3 APN 11 104633390 splice site probably benign
IGL02057:Itgb3 APN 11 104632348 missense probably damaging 1.00
IGL02192:Itgb3 APN 11 104643939 missense probably benign
IGL02604:Itgb3 APN 11 104662443 missense probably damaging 0.99
IGL02708:Itgb3 APN 11 104637829 missense possibly damaging 0.60
IGL02901:Itgb3 APN 11 104637946 missense probably benign 0.18
IGL03288:Itgb3 APN 11 104633467 missense probably damaging 1.00
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0042:Itgb3 UTSW 11 104667140 missense possibly damaging 0.80
R0123:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R0125:Itgb3 UTSW 11 104643963 missense probably damaging 1.00
R0637:Itgb3 UTSW 11 104658876 missense probably benign 0.02
R2017:Itgb3 UTSW 11 104637962 missense possibly damaging 0.70
R2200:Itgb3 UTSW 11 104640986 splice site probably null
R2225:Itgb3 UTSW 11 104665510 missense probably benign 0.00
R2429:Itgb3 UTSW 11 104637088 missense probably damaging 1.00
R3820:Itgb3 UTSW 11 104633612 nonsense probably null
R4863:Itgb3 UTSW 11 104665520 missense probably damaging 1.00
R5116:Itgb3 UTSW 11 104641077 missense probably benign 0.20
R5301:Itgb3 UTSW 11 104633654 splice site probably null
R5933:Itgb3 UTSW 11 104637979 missense possibly damaging 0.63
R6361:Itgb3 UTSW 11 104665582 missense possibly damaging 0.72
R6436:Itgb3 UTSW 11 104633492 missense probably damaging 0.99
R6452:Itgb3 UTSW 11 104633464 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTGATAAAGGAGTGAGTTTCTC -3'
(R):5'- GAGCCACACCTGTGTTGAAC -3'

Sequencing Primer
(F):5'- GGAGTGAGTTTCTCCCTACCCAC -3'
(R):5'- GTGCTTATCACGTTGGAACCCAG -3'
Posted On2014-08-25